We narrowed to 651 results for: CHI
-
TypeBlog Post... 269-272. PubMed PMID: 9657724. 6. Kapanidis, Achillefs N., Yon W. Ebright, and Richard H. Ebright. "Site-specific...
-
Sequencing Primers
TypeGuide...reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG (Invitrogen) 5' of MCS in pTrcHis vector, forward...forward primer pTrcHis Reverse GATTTAATCTGTATCAGG (Invitrogen) 3' of MCS in pTrcHis vector, same as pBAD-R,...List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'...5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward primer 35S promoter...Forward CAATTTACATCTTTATTTATTAACG (Invitrogen) For Pichia vectors with AUG1 promoter, forward primer AUG1...Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1 promoter, reverse primer BGH ... -
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...type. While transdifferentiation is suited for switching cell types between similar lineages, reprogramming... -
Molecular Biology Reference
TypeGuide...using a sequencing machine that recognizes the different fluorescent labels. The machine detects which fluorescently...replication (by bacteria) by recruiting DNA replication machinery. The ori is critical for the ability of the plasmid... in the bacteria by bacterial transcriptional machinery. Multiple Cloning Site (MCS) Short segment of ...promoter is designed to recruit transcriptional machinery from a particular organism or group of organisms... direct cell-specific expression, which can be achieved by a tissue-specific promoter (e.g., a liver-specific... when sequencing is not 100% efficient and the machine cannot distinguish between the 4 labelled nucleotides... -
Lentiviral Vector Guide
TypeGuide...system. Instead, the transfer plasmid contains a chimeric 5’ LTR fused to a heterologous promoter (often...Transfer plasmid — contains transgene and LTRs (chimeric 5’ LTR) Packaging plasmid 1 — contains gag and... to predict. In therapeutic applications, like chimeric antigen receptor T cell (CAR-T) therapy, the location...glycoprotein — transduce neural progenitor and stem cells Chimeric envelope genes have also gained popularity to ...accessibility (DIVA) identifies alterations in chromatin architecture through large-scale mapping of lentiviral integration... (1997). Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nature Biotechnology... -
Chemogenetics Guide
TypeGuide...Adeno-associated virus (AAV) is a widely-used tool for achieving in vivo expression of chemogenetic receptors, ... our AAV guide . FLEx Vectors are also used to achieve cell-specific expression of AAV-encoded chemogenetic...Mathews WB, Sysa-Shah P, Rodriguez LA, Ellis RJ, Richie CT, Harvey BK, Dannals RF, Pomper MG, Bonci A, ...M-R, Tomita Y, Nakahara J, Suhara T, Takada M, Higuchi M, Jin J, Roth BL, Minamimoto T (2020). Deschloroclozapine...Mouravlev A, Carpenter JC, Snowball A, Knauss S, von Schimmelmann M, During MJ, Lignani G, Schorge S, Young D,... -
Adeno-associated virus (AAV) Guide
TypeGuide...replication as it activates the necessary cellular machinery to produce large amounts of rAAV vectors. The ... vector depends on the cell’s DNA replication machinery to synthesize the complementary strand, transgene...rAAV capsids. Learn more about optogenetics by watching our Optogenetics 101 video or by visiting Addgene's...Kuleshova, E., Ojala, D., Huang, C. C., Gerfen, C. R., Schiller, J., Dudman, J. T., Hantman, A. W., Looger, L....replication process where the virus uses the cell machinery to produce new viruses, eventually lysing the ... -
Adenovirus Guide
TypeGuide...plasmid and the adenoviral backbone plasmid have matching left and right homology arms which facilitate ...have been developed to reduce immune response and achieve longer transgene expression. Adenoviral Types Serotypes...such as COVID-19, Ebola virus, and Zika virus. Chimpanzee adenoviral (ChAdV) vectors have also been developed...Gilbert, S. C., Hill, A. V. S., & Lambe, T. (2017). Chimpanzee adenoviral vectors as vaccines for outbreak pathogens... -
Cloning
TypeGuide...Gibson Type IIS Ligation Independent Cloning Oligo Stitching Molecular cloning or the creation of recombinant...Top Yeast-mediated Cloning and Oligonucleotide Stitching Yeast-mediated cloning is very similar in principle...advantage is the ability to perform oligonucleotide stitching, in which pieces of DNA that share no end homology... -
Gamma-Retroviral Vector Guide
TypeGuide...cancer or immunodeficiency disorders. Delivery of chimeric antigen receptor T cell (CAR-T) therapy is a particularly...vectors using a novel, CoDOn-Optimized gene for chimeric GALV envelope. Viruses , 13 (8), 1471. https:/...