We narrowed to 142 results for: GAL

...16980368. PubMed Central PMCID:PMC1635685. 12.Paez-Segala, Maria G., et al. "Fixation-resistant photoactivatable...

...-1 Cofsky, J. C., Soczek, K. M., Knott, G. J., Nogales, E., & Doudna, J. A. (2022). CRISPR-Cas9 bends ...

... Deepak Shivalila described Wave Life Science’s GalNAc-conjugated AIMer platform, which engages endogenous...

...Magnet photoswitchable proteins derived from the fungal photoreceptor, Vivid (VVD, N. crassa) (Kawano et...

...England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC...Phi80lacZΔM15 Δ-lacX74 recA1 araΔ139 D(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG tonA::Ptrc ccdA DB3.1 Invitrogen...Φ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL (StrR) nupG trfA dhfr JM109 Addgene; Promega...(TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15 e14- Φ80dlacZ∆M15 recA1 relA1 endA1 nupG rpsL...Phi80lacZM15 Δ-lacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG Common Antibiotics for ...sr1-recA) mcrB mrr hsdS20 (rB- mB-) supE44 ara14 galK2 lacY1 proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha...mcrB mrr hsdS20 (rB-, mB-) recA13 supE44 ara-14 galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ- leu mtl-1 Top10...

..., antibodies undergo a buffer exchange using centrifugal columns. The final formulation buffer is phosphate-buffered...

...28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1 Golgi...

... the CMV promoter, forms blue colonies on LB/Amp/Xgal/IPTG plate pAdx-CMV-copGFP 73346 Expresses copGFP...

...technique to beautifully demonstrate light-dependent Gal4 transcriptional activation and Cre recombination...

... Gainetdinov, I., Yoon, Y., Song, C., Cao, Y., Gallant, J., Xue, W., Rivera-Pérez, J. A., & Sontheimer... Manchado, E., Concepcion, C. P., Bonetti, C., Vidigal, J. A., Han, Y., Ogrodowski, P., Crippa, A., Rekhtman...

... Isomers (iSPI) The iSPI resource described in Galloway et al. (2022) is adapted from the synthetic human...

...Chronos & Chrimson Through de novo sequencing of 127 algal transcriptomes, as well as further optimization ...

...codon-optimized SaCas9 driven by either the ubiquitous cytomegalovirus (CMV, PX601 [#61591] ) or liver-specific tyroxine...

...opens in a new window) Heinz, N., Schambach, A., Galla, M., Maetzig, T., Baum, C., Loew, R., & Schiedlmeier...

...origin Reverse GAL1 AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG...GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10 promoter Forward Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain...domain Forward Gal4-AD AATACCACTACAATGGAT 3' end of Gal4 activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC...

... CRISPR editing, and more. Fungal Toolkit for Modular Cloning (FTK) Fungal Expression, CRISPR Arnold Driessen...Cultivarium POSSUM Toolkit Bacterial Expression, Fungal Expression Nili Ostrov , Charlie Gilbert , and ...selection markers for a variety of bacterial and fungal species for engineering non-model microbes. AspFlex...

... actin 5c gene Gal4/UAS Specific Insect Requires UAS regulatory element and yeast Gal4 gene; often used...Constitutive Mammalian Strong promoter from human cytomegalovirus EF1a Constituitve Mammalian Strong promoter...

...gene options, including: Gibbon Ape Leukemia Virus (GALV) — T and B cell transduction Murine Leukemia Virus...10.1093/nar/gkt1399 PMID: 24464997 Maetzig, T., Galla, M., Baum, C., & Schambach, A. (2011). Gammaretroviral...using a novel, CoDOn-Optimized gene for chimeric GALV envelope. Viruses , 13 (8), 1471. https://doi.org...

... Gainetdinov, I., Yoon, Y., Song, C., Cao, Y., Gallant, J., Xue, W., Rivera-Pérez, J. A., & Sontheimer... Manchado, E., Concepcion, C. P., Bonetti, C., Vidigal, J. A., Han, Y., Ogrodowski, P., Crippa, A., Rekhtman...

...Bonaventura J, Zemla R, Gomez JL, Ramirez MH, Hu X, Galvan A, Basu J, Michaelides M, Sternson SM (2019). Ultrapotent...