We narrowed to 141 results for: Gal
-
TypeBlog Post...-1 Cofsky, J. C., Soczek, K. M., Knott, G. J., Nogales, E., & Doudna, J. A. (2022). CRISPR-Cas9 bends ...
-
Optogenetics + CRISPR, Using Light to Control Genome Editing
TypeBlog Post...Magnet photoswitchable proteins derived from the fungal photoreceptor, Vivid (VVD, N. crassa) (Kawano et... -
15 Hot Plasmids from 2017
TypeBlog Post...technique to beautifully demonstrate light-dependent Gal4 transcriptional activation and Cre recombination... -
Antibody Production
TypeCollection..., antibodies undergo a buffer exchange using centrifugal columns. The final formulation buffer is phosphate-buffered... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post...Chronos & Chrimson Through de novo sequencing of 127 algal transcriptomes, as well as further optimization ... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1 Golgi... -
Molecular Biology Reference
TypeGuide...England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC...Delta-lacX74 recA1 araDelta139 D(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG tonA::Ptrc ccdA DB3.1 Invitrogen...Φ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ- rpsL (StrR) nupG trfA dhfr JM109 Addgene; Promega...(TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15 e14- Φ80dlacZ∆M15 recA1 relA1 endA1 nupG rpsL...Delta-lacX74 recA1 araD139 Delta(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG Antibiotics commonly used...sr1-recA) mcrB mrr hsdS20 (rB- mB-) supE44 ara14 galK2 lacY1 proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha...mcrB mrr hsdS20 (rB–, mB–) recA13 supE44 ara-14 galK2 lacY1 proA2 rpsL20 (StrR ) xyl-5 λ– leu mtl-1 Top10... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection... the CMV promoter, forms blue colonies on LB/Amp/Xgal/IPTG plate pAdx-CMV-copGFP 73346 Expresses copGFP... -
CRISPR Guide
TypeCollection... Gainetdinov, I., Yoon, Y., Song, C., Cao, Y., Gallant, J., Xue, W., Rivera-Pérez, J. A., & Sontheimer... Manchado, E., Concepcion, C. P., Bonetti, C., Vidigal, J. A., Han, Y., Ogrodowski, P., Crippa, A., Rekhtman... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection... Isomers (iSPI) The iSPI resource described in Galloway et al. (2022) is adapted from the synthetic human... -
Zhang Lab CRISPR Page
TypeCollection...codon-optimized SaCas9 driven by either the ubiquitous cytomegalovirus (CMV, PX601 [#61591] ) or liver-specific tyroxine... -
Tetracycline Inducible Expression
TypeCollection...opens in a new window) Heinz, N., Schambach, A., Galla, M., Maetzig, T., Baum, C., Loew, R., & Schiedlmeier... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...yes, cut (enhanced) S. pyogenes EGFP Zou pRS416gT-GalL-Cas9 79903 Yeast RPR1(TetO) yes, cut S. pyogenes... -
Sequencing Primers
TypeGuide...origin, forward primer GAL1 AATATACCTCTATACTTTAACGTC (Invitrogen) S. cerevisiae GAL1 promoter, forward primer...primer Gal10pro-F GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4...GAGTAGTAACAAAGGTCAA 3' end of Gal4 DNA binding domain, forward primer Gal4-AD AATACCACTACAATGGAT (BD Biosciences...Biosciences) 3' end of Gal4 activation domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP... -
Modular Cloning Guide
TypeGuide... CRISPR editing, and more. Fungal Toolkit for Modular Cloning (FTK) Fungal Expression, CRISPR Arnold Driessen...Cultivarium POSSUM Toolkit Bacterial Expression, Fungal Expression Nili Ostrov , Charlie Gilbert , and ...selection markers for a variety of bacterial and fungal species for engineering non-model microbes. AspFlex... -
Gamma-Retroviral Vector Guide
TypeGuide...gene options, including: Gibbon Ape Leukemia Virus (GALV) — T and B cell transduction Murine Leukemia Virus...10.1093/nar/gkt1399 PMID: 24464997 Maetzig, T., Galla, M., Baum, C., & Schambach, A. (2011). Gammaretroviral...using a novel, CoDOn-Optimized gene for chimeric GALV envelope. Viruses , 13 (8), 1471. https://doi.org... -
Promoters
TypeGuide...Constitutive Strong mammalian promoter from human cytomegalovirus EF1a Constituitve Strong mammalian promoter...expression UAS Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria... -
CRISPR Guide
TypeGuide... Gainetdinov, I., Yoon, Y., Song, C., Cao, Y., Gallant, J., Xue, W., Rivera-Pérez, J. A., & Sontheimer... Manchado, E., Concepcion, C. P., Bonetti, C., Vidigal, J. A., Han, Y., Ogrodowski, P., Crippa, A., Rekhtman... -
Chemogenetics Guide
TypeGuide...Bonaventura J, Zemla R, Gomez JL, Ramirez MH, Hu X, Galvan A, Basu J, Michaelides M, Sternson SM (2019). Ultrapotent... -
Optogenetics Guide
TypeGuide...both the identification of novel ChRs from other algal species and the development of synthetic variants...