We narrowed to 933 results for: KIN

...important factor (for instance, looking for a different conjugate or looking for antibodies validated for...unused surface-binding sites in the wells with a blocking protein such as BSA, followed by several wash ... assay, called native ChIP, does not use cross-linking and instead relies on strong interactions between...the product information for similar antibodies, looking for ones that have identical features and epitopes...

...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...choice for the delivery of CRISPR/Cas9 elements, making it one of the most common methods for in vivo CRISPR-based...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points...pioneering solutions for human genetic diseases . Cytokine & Growth Factor Reviews, 80 , 109–120. https:/...

... The entry clone now has recombined attL sites flanking your DNA fragment of interest. Now that you have...site-specific recombination or a ligation step, making it an easy, cheap, and rapid cloning method. LIC...it can be a major time- and cost-saver for labs working with yeast. Figure 7: Summary of yeast-mediated...

...setting up CRISPR experiments. We will focus on making single edits using CRISPR/Cas9 in mammalian cells... the cell type. Before proceeding, we recommend asking labmates/colleagues, searching the literature, ...efficiency. Edit Type The type of edit you are looking for will ultimately depend on which CRISPR method...

...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points...

...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...occur with contact to mucous membranes or broken skin. Needle sticks and ripped gloves are common points...

...Constitutive Mammalian Promoter from phospholycerate kinase gene U6 Constitutive Mammalian U6 nuclear promoter...

... Reverse TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA Reverse Tn7-end GGGGTGGAAATGGAGTTTTT Bacteria...

...integrative or self-replicating plasmid vectors for working in cyanobacteria. Cultivarium POSSUM Toolkit Bacterial...

...PBS on a rocking platform. Permeabilize cells for 10 min at room temperature ( RT ) on a rocking platform...PBS on a rocking platform. Section 3: Labeling with antibody Block for 20 min at RT on a rocking platform...platform in 500 µL blocking buffer. Remove the blocking buffer and dispose of it in an appropriate waste container...PBS on a rocking platform. (Optional) Counterstain nuclei with 500 µL of 300 nM DAPI working solution ...Equipment Pipette controller Pipette tips and pipettes Rocking platform Tweezers Fluorescent microscope 0.5–10...buffer: Dilute 20 µL of Triton X-100 in 10 mL PBS. Blocking buffer: Dilute 0.5 g BSA and 30 µL Triton X-100... 150 µL Triton X-100 in 50 mL PBS. 300 nM DAPI working solution: Prepare a 300 µM DAPI stock solution ...

...side up. Block the membrane in blocking buffer for 1 h at RT on a shaking platform. Wash the membrane 3x... at RT on a shaking platform. Wash the membrane 3x for 5 min in 1X TBST at RT on a shaking platform. Prepare...information specific to your antibody, such as ideal blocking buffer and optimal antibody concentrations. Consider...When the run is complete, select Done. Section 5: Blocking Prepare 1X TBST as follows: 25 mL of 20X TBS 2.5...20 472.5 mL of deionized water Mix well Prepare blocking buffer as follows: Dilute 5% w/v non-fat milk ...milk into 100 mL of 1X TBST. Pro-Tip The ideal blocking buffer will vary between antibodies. Refer to ... 3x for 5 min in 1X TBST at RT on a shaking platform. Section 6: Antibody incubation Dilute the primary...

... some times when you may be working with a protocol that requires shaking or mixing, which may produce...safety guidelines provide steps to ensure you are working in BSL-1 and BSL-2 labs safely. Protocols...safety requirements. BSL-1 is designated for those working with microbes that don’t cause disease in healthy...equipment (PPE) and wear it the whole time you are working in the lab. Do not eat, drink, chew gum, or apply...work at your lab bench. It’s possible that while working, you may accidentally come into contact with hazardous...into your eyes. Wash your hands before and after working in the lab. Ensure that a designated chemical waste...safety training before starting the work. Before working with chemicals, first review their material safety...

...Protocol Streaking Bacteria on Plates Isolate single bacterial colonies on an agar plate Streaking Bacteria...new window) Video Link Description Related Page Making LB Agar Plates Create plates to culture bacteria...Started with Tissue Culture Tips and tricks for working with tissue culture in the lab. Blog post: 10 Basic...clean workspace, and maintaining sterility while working. AAV Titration by qPCR Use qPCR to measure the ...students considering their future careers. Eric J. Perkins, PhD In this installment, we sit down with Senior...Senior Scientific Project Leader Eric Perkins to discuss the various positions he has held in his career...the works, and all of the things she loves about working at Addgene! Maria Soriano Maria Soriano, from Addgene's...

... Protocols Streaking Bacteria on LB Agar Plate Streaking and Isolating Bacteria on an...an LB Agar Plate You may also like... Making LB Agar Plates Bacterial Transformation Recovering Plasmid...explains how to isolate a single bacterial colony by streaking it onto an LB agar plate. Last Update: Feb. 28...down with a paper towel. Maintain sterility by working near a flame or bunsen burner. Obtain the approrpriate...technique is to draw in discontinuous lines. Start by streaking a vertical line of bacteria along one edge of ...

...to isolate single bacterial colonies. Equipment Shaking incubator at 37 °C Stationary incubator at 37 °... microcentrifuge or falcon tube. GENTLY mix by flicking the bottom of the tube with your finger a few ...without antibiotic) to the bacteria and grow in 37°C shaking incubator for 45 min. Pro-Tip This outgrowth step...fast and easy to use, but are less efficient at taking up larger plasmids. If you need to transform large...to ensure that your transformation procedure is working. TIP: Sometimes less is more. Although it may be...

...Antibiotic Recommended Stock Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Bleocin...appropriate sterilization technique if you are working with any weird and wonderful organisms. While your...station: Find an empty section of lab bench with a working flame. Spray down the bench with a 70% ethanol ...stop pouring and re-make the gel-mix. If you’re making plates without any antibiotic you can alternatively...viable. You can check for this possibility by streaking out both strains on plates without any antibiotic...

...Microcentrifuge Electrophoresis chamber Power supply Rocking platform Fume hood Metal spatula Razor blade Plastic...deionized water for 5 min with gentle agitation on a rocking platform. Pour off the water in the sink. Add 20...and incubate for 1 h with gentle agitation on a rocking platform. Pour off the SimplyBlue SafeStain in ...and incubate for 1 h with gentle agitation on a rocking platform. Pour off the water in the sink. Add 100...and incubate for 1 h with gentle agitation on a rocking platform. Pour off the water in the sink. Take ...

...15,000 human and 15,000 mouse genes. Addgene is working with the TRC to make this shRNA cloning vector ...the transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression of puromycin. Puro R...it has been diluted. Mix by swirling or gently flicking the tube. Incubate for 5 minutes at room temperature...the walls of the tube. Mix by swirling or gently flicking the tube. f. Incubate for 20-30 minutes at room...errors may occur. Addgene makes no warranty of any kind regarding the contents of any literature. Literature...IS” “AS AVAILABLE” basis without warranty of any kind either expressed or implied, including but not limited...

...same location. Looking at the trace file will give you more information than simply looking at the bases.... You can find Addgene's sequencing results by clicking on the "View Sequences" link on the Plasmid Information...results may indicate bases at specific locations, by looking at the trace file, you will see that these base...

... or other solutions. A key part of this task is making sure you’re weighing all reagents precisely to ...capacity for the material that you are weighing by looking for a weight range on the scale. Make sure that...how to properly dispose of reagents that you are working with. Pro-Tip When you weigh out a reagent, you...you have your reagents weighed out, you can begin making your solutions!...