...and Dutzler Labs EasyClone 2.0 Yeast Toolkit - Borodina Lab Golden GATEway cloning system - Wittbrodt ...MoClo : Modular cloning for applications like recombinant protein purification and cell-free circuit design...

.... elegans by combining expression of the FLP recombinase from either a heat-shock promoter or a tissue-specific...WormBook - A comprehensive, open-access collection of original, peer-reviewed chapters covering topics related...

... Catalytically dead dCas9 fused to a cytidine deaminase protein becomes a specific cytosine base editor...Promoter PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used to purify a region of...

...TALEN Kits CRISPR Plasmids Zinc Finger Consortium Originally published in Addgene's December 2011 Newsletter...Bogdanove Golden Gate TALEN kit. In this example, the final array is composed of 18 TAL effector repeats. The...

...in a higher background of non-recombinant adenoviral plasmids. Recombinant adenoviral plasmids are then... other patterns of recombination have not occurred. Once verified, the recombinant plasmid is linearized...transcripts. At either end of the genome are i nverted t erminal r epeats (ITRs). Genes are divided into early (...Coxsackie-Adenovirus Receptor (CAR) to enter cells. Recombinant adenovirus has two genes deleted: E1 and E3. ...left and right arms to facilitate homologous recombination of the transgene into the adenoviral plasmid...right homology arms which facilitate homologous recombination of the transgene into the adenoviral plasmid...single-stranded DNA parvovirus and was discovered as a contaminant of adenovirus preparations, whereas adenoviruses...

...Antibodies produced this way are called recombinant antibodies. Recombinant antibodies are created by cloning... time and labor intensive. Recombinant expression validation A recombinant expression strategy is used...cultured immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals... of a single antibody with little variation. Recombinant plasmids - Antibodies can be produced from plasmids... and can either be used while suspended in the original media or isolated and placed in a buffer. Antibody... binding site. This process, known as V(D)J recombination, allows for a wide variety of antibodies to ...abundant isotype in blood, also found in tissues; predominant isotype in secondary immune response Monomer ...

... BL 2012. Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression...delay the closing of the channel 470(activ.), 590(inact.) ReaChR Red-activatable variant of CrChR2 590 Channelrhodopsins...chloride pump from Haloarcula (Halobacterium) salinarum (strain Shark), used to silence neuronal activity...short or long periods of neuronal activation/inactivation periods. These can range from msec (hChR2) to...expression of the opsin and the area that is being illuminated. There are several different ways to control ...especially powerful when combined with site specific recombinase technology like Cre-lox, which allows you to ...one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half to CIB1,...

...Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive or inducible expression...Fraser 15948 pLOVE 3rd Tet inducible gateway destination plasmid for cDNA expression Ramalho-Santos 24129...

... Rep and Cap, flanked by two 145 base inverted terminal repeats (ITRs). These ITRs base pair to allow ...is necessary for lytic cycle activation. When recombinant AAV (rAAV) is used for research purposes, the...the Rep protein is supplied in trans , eliminating the ability of rAAV to integrate into its preferred ...AAV8 Photoreceptor Cells AAV2, AAV5, AAV8 RPE (Retinal Pigment Epithelium) AAV1, AAV2, AAV4, AAV5, AAV8...spontaneously annealing, upon infection, which eliminates the requirement for host cell DNA synthesis. ...increasing packaging capacity depends on homologous recombination. In this method, a gene is divided between two...sequence overlap. Co-expression induces homologous recombination and expression of the full-length transgene ...

...T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator, reverse primer Tac promoter ...GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC ...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT...primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen...Invitrogen) CYC1 transcription termination signal, reverse primer DsRed1-C AGCTGGACATCACCTCCCACAACG (BD... GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC ...

...developed. tTA was created by fusing tetR with the C-terminal domain of VP16 (virion protein 16), an essential...appropriate. If your gene of interest should be mostly inactive, and only turned on occasionally, using tetracycline...

...interest: The transgene sequence is flanked by long terminal repeat (LTR) sequences, which facilitate integration...line that stably expresses Gag-Pol and/or Env, eliminating the need to deliver these genes in trans by specific...feature may be useful for the transduction of terminally differentiated (non-dividing) cells. Both lentiviruses... only in lentivirus. Are γ-retroviruses self-inactivating (SIN)? They can be. Plasmids that encode SIN...export. LTR Subcomponents: U3 R U5 in cis LTR; Long terminal repeats; U3-R-U5 regions found on either side ...U5 and the rest of the provirus. 3' LTR in cis Terminates transcription started by 5' LTR by the addition...

... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...

...transcription factors bind. Distal Promoter The final portion of the promoter region is called the distal...Constitutive Mammalian promoter from phospholycerate kinase gene TRE Inducible Tetracycline response element...Plasmids 101: Repressible Promoters Plasmids 101: Terminators and PolyA signals...

...Consortium (CMC) Plasmids You may also like... Human Kinase ORF collection Fluorescent Protein Tools CRISPR...

...gene networks. Examples Include: promoters and terminators repressors and activators logic gates Networks...

...Design Tools CRISPR Blog Posts A catalytically inactive Cas9 (dCas9) is fused to FokI nuclease. When FokI...

...Reporters and Tags Library Construction Integration Recombination Shuttle Vectors Plasmids for Cloning and Genomic...

...feature of the KLF family is the presence of three C-terminal Krüppel-like zinc fingers which bind to CACCC ...

...the catalytic domain of ADAR2(E488Q) adenosine deaminase to catalytically dead Cas13b creates a programmable...