Skip to main content
Addgene

We narrowed to 14 results for: ina

Showing: 1 - 14 of 14 results
  1. Adenovirus Guide

    Type
    Guide
    ...carryover from the HV in final viral preparations. Several methods to avoid HV contamination have been developed...in a higher background of non-recombinant adenoviral plasmids. Recombinant adenoviral plasmids are then... other patterns of recombination have not occurred. Once verified, the recombinant plasmid is linearized...vectors for recombinant adenoviral vector production that do not contain GFP. Recombinant adenoviral vector...heavily-spliced transcripts flanked by two inverted terminal repeats (ITRs). Adenoviral genes are divided into...Parvoviridae family. AAVs were discovered as a contaminant of adenovirus preparations, which is how they...information about AAVs, read our AAV guide . Recombinant Adenoviral Vectors Wild-type adenoviruses have...
  2. CRISPR Guide

    Type
    Guide
    ... catalyze cytidine deamination instead of (or in addition to) adenosine deamination, producing cytosine...Plasmids: CRISPR transposases CRISPR Recombinases and Integrases Recombinases, and their subfamily integrases...interesting adaptive immune response that detects and eliminates foreign DNA, which scientists have modified for...target sequence present in the gRNA. CRISPR was originally employed to knock out target genes in various...SpCas9, has one active nuclease domain and one inactivated one, allowing it to generate DNA nicks by cutting...cutting only one strand. Catalytically inactive “dead” Cas9 (dCas9) contains mutations in both nuclease...backbone HypaCas9 - increase Cas9 proofreading and discrimination evoCas9 - decrease off-target effects xCas9...
  3. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Guide . Recombinant AAV Vectors Wild-type AAVs have been modified by researchers to create recombinant adeno-associated...diversity of diseases such as inherited retinal disease, spinal muscular atrophy, hemophilia A and B, and...frames, Rep and Cap, flanked by two 145 bp inverted terminal repeats (ITRs). The Rep region encodes four non-structural...Parvoviridae family. AAVs were discovered as a contaminant of adenovirus preparations, which is how they...in order to deliver genetic cargo into cells. Recombinant AAV constructs are designed by replacing the ...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid... When cloning your plasmids, be sure to use recombination deficient bacterial strains, such as NEB Stable...
  4. Molecular Biology Reference

    Type
    Guide
    ... codon combinations each amino acid is encoded for by multiple codons. Plasmids and Recombinant DNA Technology...field of recombinant DNA, in which many identical DNA fragments can be generated. The combination of a DNA...chromosomes, which are composed of DNA. These findings culminated in the central dogma of molecular biology, that...This obstacle has been overcome by the field of recombinant DNA technology, which enables the preparation... reference to any extrachromosomal heritable determinant. Plasmids are fragments of double-stranded DNA...a plasmid or vector DNA backbone generates a recombinant DNA molecule, which can be used to study DNA ...fragments of interest, such as genes. Creation of recombinant DNA Molecular Cloning Plasmids that are used ...
  5. Cloning

    Type
    Guide
    ...Stitching Molecular cloning or the creation of recombinant DNA is an essential process used in scientific... most popular cloning methods used to create recombinant DNA. Restriction Enzyme Cloning Restriction enzyme... Restriction cloning ) Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid ...101: Gateway Cloning ) Gateway® cloning is a recombination based cloning method. The benefit of Gateway...one plasmid into another is done via a single recombination reaction, drastically simplifying the process...plasmid must already be surrounded by specific recombination sites (in this regard, not so dissimilar from...rapidly shuttled into any compatible Gateway® Destination vector, which contain attR sites via LR clonase...
  6. Modular Cloning Guide

    Type
    Guide
    .... lipolytica . EXPRESSYALI Yeast Expression Irina Borodina Plasmids for assembly of single and multi-gene...tags, 6 CDSs, 9 terminators, 4 nonfunctional "dummy" parts, 34 backbones, and 6 destination vectors for use...method for creating many plasmids from different combinations of a common set of components (Weber et al.,...basic parts (promoters, UTRs, coding sequences, terminators, etc.) flanked by fusion sites into individual... signal peptide, a protein-coding gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules... only by the ability of E. coli to maintain the final plasmid after transformation. Figure 1: Overview...chloroplast-specific genetic modules, including destination vectors specific for tobacco ( N. tabacum ) or...
  7. Lentiviral Vector Guide

    Type
    Guide
    ...regulatory genes, accessory genes, and the long-terminal repeats (LTRs) necessary for integration. Not ... a heterologous promoter (often CMV or RSV), eliminating the need for transactivation by Tat. Most third-generation...contain a deletion in the 3’ LTR to make them self-inactivating (SIN). This deletion is transferred to the 5...incompetent by using four plasmids instead of three and eliminates the requirement for Tat. Always includes deletion...deletion in the 3' LTR for self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid... When cloning your plasmids, be sure to use recombination-deficient bacteria strains, such as NEB Stable...
  8. Antibody Guide

    Type
    Guide
    ...Antibodies produced this way are called recombinant antibodies. Recombinant antibodies are created by cloning... time and labor intensive. Recombinant expression validation A recombinant expression strategy is used...cultured immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals... of a single antibody with little variation. Recombinant plasmids - Antibodies can be produced from plasmids... and can either be used while suspended in the original media or isolated and placed in a buffer. Antibody... binding site. This process, known as V(D)J recombination, allows for a wide variety of antibodies to ...abundant isotype in blood, also found in tissues; predominant isotype in secondary immune response Monomer ...
  9. Optogenetics Guide

    Type
    Guide
    ... BL 2012. Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression...delay the closing of the channel 470(activ.), 590(inact.) ReaChR Red-activatable variant of CrChR2 590 Channelrhodopsins...chloride pump from Haloarcula (Halobacterium) salinarum (strain Shark), used to silence neuronal activity...short or long periods of neuronal activation/inactivation periods. These can range from msec (hChR2) to...expression of the opsin and the area that is being illuminated. There are several different ways to control ...especially powerful when combined with site specific recombinase technology like Cre-lox, which allows you to ...one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half to CIB1,...
  10. Sequencing Primers

    Type
    Guide
    ...T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator, reverse primer Tac promoter ...GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC ...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT...primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen...Invitrogen) CYC1 transcription termination signal, reverse primer DsRed1-C AGCTGGACATCACCTCCCACAACG (BD... GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC ...
  11. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...strand of RNA contains packaging genes and the long-terminal repeats (LTRs) necessary for integration. Wildtype...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid... When cloning your plasmids, be sure to use recombination-deficient bacteria strains, such as NEB Stable... strains reduce the frequency of homologous recombination of unstable regions, like the LTRs found in ...engineered to stably express gag-pol and/or env , eliminating the need to deliver these genes on separate plasmids...envelope and packaging plasmids. Unless multiple recombination events occur between the packaging, envelope...that have been deposited with Addgene are self-inactivating (SIN). These plasmids have a deletion in the...
  12. Promoters

    Type
    Guide
    ...transcription factors bind. Distal Promoter The final portion of the promoter region is called the distal...Constitutive Mammalian promoter from phospholycerate kinase gene TRE Inducible Tetracycline response element...Plasmids 101: Repressible Promoters Plasmids 101: Terminators and PolyA signals...
  13. Chemogenetics Guide

    Type
    Guide
    ...optogenetics workflows (such as laser or LED illumination), making LMOs a versatile option. Coupling brighter...Suhara T, Takada M, Higuchi M, Jin J, Roth BL, Minamimoto T (2020). Deschloroclozapine, a potent and selective...
  14. Plan Your Experiment

    Type
    Guide
    ...RNA (gRNA), the design of the gRNA sequence, and finally how to validate your genetic edit. Figure 1: Flow...expression with AAVs can be long-lived, despite recombinant AAVs not integrating into the host genome. Scientists...
Showing: 1 - 14 of 14 results