Skip to main content

We narrowed to 1,017 results for: ple

Showing: 121 - 140 of 1017 results
  1. Chemogenetics Guide

    Type
    Guide
    ...chemogenetic receptors were based on G-protein coupled receptors (GPCRs) . The largest class of cell surface...like RASSLs, are based on engineered G-protein coupled receptors, but unlike RASSLs, show insensitivity...classified by the signaling protein that the receptors couple to: Gq-DREADDs Gq-DREADDs signal through the Gαq...is not widely used. There is also a DREADD that couples to β-arrestin to activate noncanonical GPCR signaling...For a discussion of alternative DREADD ligands, please see the text. PSAMs Unlike DREADDs, which manipulate...allowed them to respond to their cognate PSEM. For example, PSAM Q79G,Q139G is activated by PSEM 22S , while...developed as agonists for PSAM4. A given PSAM is coupled with an ion pore domain (IPD) to form ligand-gated...
  2. Molecular Cloning Techniques

    Type
    Guide
    ...overhang (blunt ends). Two pieces of DNA that have complementary overhangs, or which are both blunt-ended, can...popular restriction enzyme sites, usually within the multiple cloning site (MCS). You can easily move (subclone...experimental goal. Although Gateway cloning is a simple and efficient cloning method, Gateway vectors and...restriction cloning, once your project has been completed via Gateway cloning. Addgene's collection contains...method that relies on the hybridization of the complementary base pairs adenine (A) and thymine (T). TOPO...overhang on the 3' end of PCR products. The complementary T comes from a pre-cut, linear, cloning-ready... cloning is that it allows for the assembly of multiple fragments of DNA in the chosen orientation at ...
  3. Molecular Biology Reference

    Type
    Guide
    ...combinations and only 20 natural amino acids, so multiple codons can encode the same amino acid — a phenomenon... vary broadly in their functionality. In their simplest form, plasmids require a bacterial origin of replication...providing a survival advantage to the bacterial host. Multiple Cloning Site (MCS) A short segment of DNA which... DNA fragments. Cloning vectors tend to be very simple, often containing only a bacterial resistance gene... as cloned DNA, and this process of generating multiple identical copies of a recombinant DNA molecule...for Plasmid Selection Each bacterium can contain multiple copies of an individual plasmid, and ideally would...pressure to maintain and replicate your plasmid over multiple generations. It is important to distinguish that...
  4. Guide to Using Pooled Libraries

    Type
    Guide
    ...recommended to verify that the library is complete — an incomplete library may lead to false positives or...genes that contribute to a phenotype. At their simplest level, pooled libraries are single preparations... unique gene targeting sequence, but there are multiple sequences targeting each gene in the overall library...lineage tracing or parsing the effects of expressing multiple genes at once. A well-designed screen can help...your screen. If you need to amplify the library, please refer to the depositor’s protocol for the best ...number of plasmids present in the library — for example, the Moffat lab uses 200x the number of cells as...method relevant to the phenotype being studied. Examples of published selection mechanisms for lentiviral...
  5. Plan Your Experiment

    Type
    Guide
    ...CRISPR/Cas9 in mammalian cells as an example, but many of these principles also apply to using CRISPR in other...while testing multiple gRNAs is a good idea for most CRISPR experiments, testing multiple pegRNA designs... process of interest. Do you want to: Generate complete and permanent loss of gene expression or function...perfect world, your gRNA sequence would be an exact complement to your target sequence with no homologous sites...selecting a gRNA, but you likely won’t be able to completely avoid them. To increase specificity, consider...the genomic region you intend to target in your samples to ensure there are no discrepancies with the reference...produce the Cas enzyme, and the enzyme then forms a complex with the gRNA for CRISPR activity. Because you ...
  6. Promoters

    Type
    Guide
    ... transcription is simpler than eukaryotic transcription, bacteria still have complex systems of gene regulation... including transcription and the transcription complex. Educational...other hand, the process in eukaryotes is much more complex. Eukaryotes require a minimum of seven transcription...transcription. The Lac operon in bacteria is an example of a negatively-controlled operon (Figure 3). A...involved in the production of tryptophan is an example of a positively-controlled operon. Figure 3: Lac...Eukaryotic Promoters Eukaryotic promoters are much more complex and diverse than prokaryotic promoters and span... start site (TSS). Eukaryotic promoters are so complex in structure that the DNA tends to fold back on...
  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...as adenovirus or herpes simplex virus to replicate in the host cell and complete the lytic cycle. AAVs ...transduction efficiency and alter tropism. For example, AAV2/5, targets neurons that are not efficiently...Hybrid capsids are engineered capsids derived from multiple different serotypes, which can further alter transduction...transduction efficiency and viral tropism. One common example is AAV-DJ, which contains a hybrid capsid derived...blog post on AAVrg for more information. Self-complementary AAV (scAAV) One downside of the use of AAVs ...DNA replication machinery to synthesize the complementary strand, transgene expression may be delayed....capacity of rAAV vectors to ~2.4 kb. Figure 4: Examples of AAV serotypes, pseudotypes, hybrid capsids,...
  8. Lentiviral Vector Guide

    Type
    Guide
    ...hence the use of “retro”. Lentiviruses have more complex genomes, containing packaging genes and accessory...along with virus-specific accessory genes (for example, vif , vpr , vpu , and nef for HIV-1). The LTRs...comparison of second- and third-generation systems, please refer to Table 1. Figure 4: Third-generation lentiviral...integration sites have led to the development of multiple genome-wide analysis pipelines to assess viral...Timms et al. (2018), and Wells et al. (2020) for examples). Pseudotyping Tropism dictates which types of...in the envelope and packaging plasmids. Unless multiple recombination events occur between the packaging.... (2021). CReVIS-Seq: A highly accurate and multiplexable method for genome-wide mapping of lentiviral...
  9. Adenovirus Guide

    Type
    Guide
    ...genomes range between 26–45 kb in length and contain multiple heavily-spliced transcripts flanked by two inverted...harvested about 7–10 days later. Vogelstein designed multiple shuttle plasmids for different purposes. The pAdTrack...that the infection rates are equivalent across multiple viruses. The adenoviral backbone plasmid pAdEasy...transduction efficiency, tropism and immunogenicity. For example, Ad5/35 and Ad5/26 combine the high transduction...packaging capacity. Large protein-coding genes and complex gene expression cassettes are often too big to ... also been developed as vaccine candidates for multiple infectious diseases and prostate cancer. Cancer...
  10. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... — hence the use of “retro”. Retroviruses have simpler genomes, containing only the necessary packaging...transfection step of the viral packaging cell line. For example, Phoenix™ is a popular second-generation gamma-...in the envelope and packaging plasmids. Unless multiple recombination events occur between the packaging...Hughes, S. H., & Varmus, H. E. (Eds.). (1997). Principles of Retroviral Vector Design. In Retroviruses ...
  11. Sequencing Primers

    Type
    Guide
    ...from most sequencing services, along with a more complete list of common sequencing primers. These lists...molecular biology, plasmids, and recombinant DNA, please consult Addgene's Molecular Biology Reference page...pGL3 vector Forward SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR Forward SP6 ATTTAGGTGACACTATAG...
  12. Which Fluorescence Microscopy Technique is Best for Me?

    Type
    Blog Post
    ...between the glass coverslip and a sample in aqueous buffer it is completely reflected. This reflection occurs...water-like buffer the sample is immersed in. Although the excitation light is completely reflected, energy...microscope to use for a new sample I always start by asking two questions: 1) Is the sample dynamic or static? ...? 2) Is the sample thin (< 15 μm) or thick? These questions will place each sample into one of four categories...capture in these types of samples is their fast movements. Depending on the sample, a temporal resolution... fluorophores higher in the sample. TIRF is also very gentle on the sample as the majority of the laser...sheets of excitation light through multiple focal planes of a sample may also be useful for providing fast...
  13. A Control for All Seasons

    Type
    Blog Post
    ...more complex experiments. A multiplexed experiment, for example, requires staining with multiple primary...control is generally a sample or group that will have a desired response. For example, if you are studying...to experimental samples (?). B, The inclusion of biological replicates such as multiple mice in each group...control is a sample or group that is not subjected to the experimental condition. In the example above, a ...inhibitors on mice, for example, it would be better to treat and test multiple mice with the drug rather... wild-type and knockout samples. In this test, wild-type and knockout samples are treated with the identical...present in the wild-type samples and absent in the knockout.  If knockout samples are unavailable, try substituting...
  14. The Power Behind NGS Plasmid Validation: seqWell

    Type
    Blog Post
    ...numbers of plasmids. plexWell™ technology overview For any NGS experiment, the DNA sample being sequenced ...costly library prep, as each sample requires an individual library. The plexWell™ workflow is a sequential...carrying sample-specific barcodes. Rather than continuing to process 100s to 1000s of samples individually... of plexWell™’s sequential tagging procedure, the quantities of library molecules for each sample remain... problem in multiplex NGS library preparation. The challenge here is that, as more samples are sequenced...case that individual libraries prepared from multiple samples will then also need to be quantified and re-normalized...in order to be combined with other samples in a single multiplexed pool. The cost of these normalization...
  15. Antibodies 101: Introduction to Immunofluorescence

    Type
    Blog Post
    ...visualize multiple targets at once. An advantage of multiplexing is that you can ask how multiple proteins... sample type. Sample Preparation This step can involve multiple smaller steps that all help to ensure...and colors makes it easy to perform multiplexed IF. By using multiple primary antibodies made in different... maintains sample morphology with minimal impact to the target epitope. There are multiple methods for...methods you use will depend on target and sample type. Example steps include: permeabilization, antigen...target and sample type. Primary Antibody This is the first antibody applied to your sample, which will... and Imaging Similar to Sample Preparation, this step can involve multiple smaller steps, but the aim...
  16. Analyzing CRISPR Editing Results with ICE from Synthego

    Type
    Blog Post
    ...detect or analyze complex edits, such as those generated by multiplexed delivery of multiple sgRNAs. Since...For a multiplex sample, ICE includes visual representations of all detected edit types in the sample. The...with each sample. Successfully analyzed samples will display the following parameters: Sample - The unique...indel.   For a complete guide to ICE analysis, including detailed explanation and examples, read the paper...the ICE software has two analysis formats: sample by sample analysis, which can compare up to five editing...results and a list of the analyzed samples (see below).   If the sample run had no issues, the analysis ...perform more in-depth analyses on each sample by clicking on the sample name or on its corresponding bar graph...
  17. What’s in Your Tube?: A Quick Guide to Measuring DNA by Spectrophotometry

    Type
    Blog Post
    ... easy to measure sample concentration and purity using only a tiny bit of the sample itself — so easy ...NanoDrop. The principles will apply to similar instruments from other companies, like the Implen NP80 or DeNovix...instrument can calculate a sample’s nucleic acid concentration based on the sample’s absorption at 260 nm (...spectra of a mixed sample.  But, other molecules that may be present in the sample also absorb light...levels exceed 70% of the sample content (Loughrey and Matlock, 2016). So, even samples with “good” A260/280...nm, you may have phenol in your sample.  RNA contaminants DNA samples can also be contaminated with RNA.... To confirm RNA in your DNA sample, you will need to use a complementary assay, such as a fluorescence...
  18. Polymerase Chain Reaction Overview and Applications

    Type
    Blog Post
    ...emulsion droplet technology that fractions the PCR reaction sample into approximately 20,000 droplets. Each... our blog post “Droplet Digital PCR for AAV Quantification.”   Multiplex PCR Multiplex PCR, as the name...utilize multiplex qPCR to quantify the concentrations of multiple starting DNA templates in one sample. It...target DNA levels Multiplex PCR Amplify multiple targets from one sample Disease or pathogen identification... molecular diagnostics.  Digital droplet PCR, ddPCR  Digital droplet PCR or ddPCR is a method that provides...analyzed by a droplet reader, which measures the fluorescence amplitude of each droplet. The fraction ...method in which multiple targets can be amplified in a single PCR experiment using multiple primers all in...
  19. Antibodies 101: Flow Cytometry

    Type
    Blog Post
    ...detecting specific populations of cells in a complex tissue or sample (1). When combined with cell sorters, ...information about the cell’s complexity. A cell with a high degree of internal complexity such as extensive membranes... of cells. During FACS, the sample stream oscillates to generate droplets that are charged as they pass...plate. Each droplet contains a single cell that is assessed for the desired parameter. A droplet containing...rule out dead cells and debris. For example, a whole blood sample will contain a mix of cells including...differences in their size and complexity, cells from a whole blood sample will separate into distinct populations...ensure that samples are single cell suspensions. For cells that tend to aggregate, pass the sample through...
  20. Deep Dive: Statistical Tests (Comparisons)

    Type
    Blog Post
    ...can test three or more groups (two samples and a control, for example) simultaneously, with up to two independent...differences exist between. For example, if an ANOVA analysis on a five-sample data set yields statistical...appropriate to use if all sample comparison is needed, without a high number of samples (~5). Tukey’s test ...positives. Control vs. all samples Oftentimes there exists a control group and multiple experimental groups,...test assumes your data follows. Fig. 1: Examples of comparable groups with and without equal levels... variance among data.     Fig. 2: Examples of data distribution profiles.   Parametric...They are classic parametric tests and one of the simplest statistical tests available. Tailed t-tests If...
Showing: 121 - 140 of 1017 results