Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 33 results for: Beta-s;

Showing: 1 - 20 of 33 results

  1. GPCRs: How Do They Work and How Do We Study Them?

    Type
    Blog Post
    ...10.1016/j.neuron.2016.01.040 Takeda S, Kadowaki S, Haga T, Takaesu H, Mitaku S (2002) Identification of G protein-coupled...consist of a trimer of three subunits: alpha (Gα), beta (Gβ), and gamma (Gγ). G proteins are divided into...et al., 2015). PRESTO-TANGO uses a modified Tango beta-arrestin recruitment assay to measure receptor activation... In this assay, binding of an agonist recruits a beta-arrestin-TEV protease fusion to a receptor-transcription...kit consists of 20 plasmids encoding 14 alpha, 2 beta, and 4 gamma subunits of the heterotrimeric G protein...

  2. Understanding GPCR Signaling Using TRUPATH

    Type
    Blog Post
    ...10.1038/s41589-020-0535-8 Takeda S, Kadowaki S, Haga T, Takaesu H, Mitaku S (2002) Identification of G protein-coupled...complex consists of a trimer of three subunits: alpha, beta, and gamma (Gα, Gβ, and Gγ), collectively known ...or BRET2. With binding of the drug, the alpha and beta subunits dissociate resulting in decreased BRET2... 950 different human genes encoding GPCRs (Takeda S et al., 2002) and many downstream complexes involved...

  3. CRISPR Antimicrobials

    Type
    Blog Post
    ... population. Yosef et al.’s proof-of-concept work targeted two distinct beta-lactam resistance genes, ...certain bacteria (Figure 1). Citorik et al. targeted beta-lactam and quinolone resistance genes in E. coli...CRISPR antimicrobials successfully resensitized a beta-lactam resistant population to the antibiotic, despite... et al. used a phagemid system to target virulent S. aureus, a common hospital-borne infection. Two rounds...phagemid treatment decreased the proportion of virulent S. aureus from 50% to 11% in just 24 hours.   ...antibiotic-resistant bacteria.” Proc Natl Acad Sci U S A. 9;112(23):7267-72. (2015). PubMed: PMID 26060300...

  4. Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering

    Type
    Blog Post
    ...whose entire complementary strand was degraded. Beta: Beta protects the ssDNA created by Exo and promotes...system has three components (Figure 1): 1) Exo, 2) Beta, and 3) Gam. All three are required for recombineering...recombineering with a dsDNA substrate; however, only Beta is required when generating a modification with an... a complementary ssDNA target in the cell.  Only Beta expression is required for recombineering with an...).  In some of these strains, expression of exo, beta and gam is tightly regulated by the endogenous phage...to re-nature and again repress expression of exo, beta and gam.  A major advantage of using this method...-100 nucleotides long with the desired alteration(s) located in the center of the sequence. Since lambda...

  5. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...ubiquitous. human beta actin General expression mRNA Mammalian promoter from beta actin gene Constitutive...  Contains CMV enhancer, chicken beta actin promoter, and rabbit beta-globin splice acceptor. TRE General...interest will be expressed.      The RNA polymerase(s) RNA is transcribed from DNA using an RNA polymerase...

  6. Multiplexed Capture of Promoter-enhancer 3D Chromatin Structures Using CRISPR

    Type
    Blog Post
    ...interactions at a promoter in the well-characterized beta globin locus. The two methods had similar rates ...interactions at five sites in the well-characterized beta-globin locus were analyzed with CAPTURE 2.0, with...biotin acceptor site BirA, a biotin ligase a gRNA(s) targeting a single genomic location of interest  ... Number of loci targeted One Many Sample type(s) Cell lines Cell lines, primary cells Table 1: ...methods.   Applications of CAPTURE 2.0 CAPTURE 2.0’s increased rate of detecting chromatin interactions...they are a large cluster of enhancers. CAPTURE 2.0’s multiplexing and high resolution allowed the Xu Lab...Li K, Cao H, Ni M, Liu Y, Gu Z, Dickerson KE, Xie S, Hon GC, Xuan Z, Zhang MQ, Shao Z, Xu J (2017) In ...

  7. Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2:  Reprogramming and Transdifferentiation

    Type
    Blog Post
    ... of adult pancreatic alpha-cells to beta-cells after extreme beta-cell loss. Nature, 2010. 464(7292): ...reprogramming of adult pancreatic exocrine cells to beta-cells. Nature, 2008. 455(7213): p. 627-32. PubMed...861-72. PubMed PMID: 18035408. 3. Takahashi, K. and S. Yamanaka, Induction of pluripotent stem cells from...temperature-sensitive Sendai virus vectors. Proc Natl Acad Sci U S A, 2011. 108(34): p. 14234-9. PubMed PMID: 21821793... of canonical Wnt signaling. Proc Natl Acad Sci U S A, 2012. 109(27): p. E1848-57. PubMed PMID: 22645348...10): p. 1836-46. PubMed PMID: 22976355. 34. Wang, S., et al., Differentiation of human induced pluripotent...p. 82-94. PubMed PMID: 23329641. 36. Jopling, C., S. Boue, and J.C. Izpisua Belmonte, Dedifferentiation...

  8. Lentiviral Vector Uses and Overview

    Type
    Blog Post
    ...Naldini et al. transduced rat neurons in vivo with beta-gal and other reporters, and they showed that expression...common hematopoietic disorders sickle cell anemia and beta-thalassemia. Lentiviral vectors are promising agents... Kabbara N, Dalle B, Gourmel B, Socie G, Chrétien S, Cartier N, Aubourg P, Fischer A, Cornetta K, Galacteros...Beuzard Y, Gluckman E, Bushman F, Hacein-Bey-Abina S, Leboulch P. Nature. 2010 Sep 16;467(7313):318-22....

  10. Plasmids 101: TOPO Cloning

    Type
    Blog Post
    ...often have the topoisomerase site inserted into a beta-galactosidase cassette allowing a researcher to ... colonies within 8 hours. References: 1. Shuman S. "Recombination mediated by vaccinia virus DNA topoisomerase...coli is sequence specific."  Proc Natl Acad Sci U S A.  1991 Nov 15;88(22):10104-8. PubMed PMID: 1658796...synthesis using vaccinia DNA topoisomerase. Shuman S. J Biol Chem.  1994 Dec 23;269(51):32678-84. PubMed...

  12. Split Fluorescent Proteins for Studying Protein-Protein Interactions

    Type
    Blog Post
    ...protein labeling and signal amplification. Zhou S, Feng S, Brown D, Huang B. PLoS One. 2020 Bo Huang Yellow...editing (Feng Zhang Lab 2015)  Reference Feng, S., Sekine, S., Pessino, V. et al. Improved split fluorescent...according to the number of strands in the canonical beta-barrel structure. Most frequently, the proteins ...oligomerisation. Eastwood T, Baker K, Brooker H, Frank S, Mulvihill DP. FEBS Lett. 2017 Dan Mulvihill mVenus...visualization of endogenous proteins and synapses. Feng S et al. Commun Biol. 2019 Bo Huang Near-Infrared ...protein-protein interactions in living cells. Shao S, Zhang H, Zeng Y, Li Y, Sun C, Sun Y. Commun Biol....

  13. Negative Can Be Positive: Open AAV Data with Addgene

    Type
    Blog Post
    ...Sierra-Mercado, D., Robinson, J. O., Outram, S., Koenig, B. A., Pereira, S., McGuire, A. L., & Lázaro-Muñoz, G....High-magnification images immuno-stained against dopamine beta-hydroxylase (DBH, magenta) to label norepinephrine...and resources References Dayton, R. D., Grames, M. S., & Klein, R. L. (2018). More expansive gene transfer...doi.org/10.1089/hgtb.2019.105 Rumachik, N. G., Malaker, S. A., Poweleit, N., Maynard, L. H., Adams, C. M., Leib... Leib, R. D., Cirolia, G., Thomas, D., Stamnes, S., Holt, K., Sinn, P., May, A. P., & Paulk, N. K. (2020...

  14. Plasmids for Stem Cell Research

    Type
    Collection
    ...Cells Beta-cells Adenoviral Mouse In vivo reprogramming of adult pancreatic exocrine cells to beta-cells...induced Beta Cells Adenoviral Mouse Long-term persistence and development of induced pancreatic beta cells...induced pluripotent stem cells. Proc Natl Acad Sci U S A. 2014 Jul 22;111(29):10678-83. Capecchi Replicating...single polycistronic vector. Proc Natl Acad Sci U S A. 2009 Jan 6. 106(1):157-62. Jaenisch Lentivirus ... of canonical Wnt signaling. Proc Natl Acad Sci U S A. 2012 May 29. Palecek Fibroblasts Cardiomyocytes...fibroblasts to dopaminergic neurons. Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10343-8. Parmar Fibroblasts...tripotent neural precursor cells. Proc Natl Acad Sci U S A. 2012 Feb 14;109(7):2527-32. Wernig Fibroblasts ...

  15. Plasmids 101: Terminators and PolyA signals

    Type
    Blog Post
    ...efficient rabbit beta-globin mRNA 3' end formation. Cell. 1987. PMID: 3568131.  Hager S, Frame FM, Collins...by secondary structure. It is thought that poly(A)s are used to control the cellular concentration of ...

  16. Tips for Screening with Yeast Two Hybrid Systems

    Type
    Blog Post
    ...Casadaban M.J., Martinez-Arias A., Shapira S.K., Chou J. Beta-galactosidase gene fusions for analyzing gene expression... heterologous systems (e.g. mammalian proteins in S. cerevisiae). While this may be difficult to resolve...1985; 43:729-736. PubMed PMID: 3907859. 4. Fields, S., Song, O. A novel genetic system to detect protein-protein...membrane protein interactions. Proc Natl Acad Sci U S A. 2004; 101(33):12242–12247. Pubmed PMID: 15299147...

  17. Sequencing Primers

    Type
    Guide
    ...CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron, forward primer Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit beta-globin intron...Invitrogen) S. cerevisiae GAL1 promoter, forward primer Gal10pro-F GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae...reverse primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region, reverse primer CAT-R GCAACTGACTGAAATGCCTC...reverse primer pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer... reverse primer XBG-R GACTCCATTCGGGTGTTC Xenopus beta-globin 3'UTR, reverse primer XEF1a TTTCGCCCTAACTTCGTGAT... 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG... reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG...

  18. Immunology Research Plasmids and Resources

    Type
    Collection
    ...inhibin, beta A EDF, FRP INHBB inhibin, beta B MGC157939 INHBC inhibin, beta C IHBC INHBE inhibin, beta E MGC4638...regulatory subunit B, beta isoform PPP3RL PRKCB protein kinase C, beta MGC41878, PKC-beta, PKCB, PRKCB1, PRKCB2...gonadotropin, beta polypeptide 7 CG-beta-a, FLJ35403, FLJ43118 CGB8 chorionic gonadotropin, beta polypeptide...Era, NR3A1 ESR2 estrogen receptor 2 (ER beta) ER-BETA, ESR-BETA, ESRB, ESTRB, Erb, NR3A2 ESRRA estrogen-related...factor, beta 1 CED, DPD1, TGFB, TGFbeta TGFB2 transforming growth factor, beta 2 MGC116892, TGF-beta2 TGFB3...catalytic, beta polypeptide DKFZp779K1237, MGC133043, PI3K, PI3KCB, PI3Kbeta, PIK3C1, p110-BETA PIK3CD phosphoinositide...

  19. Viral Vectors 101: AAV Variables That Matter

    Type
    Blog Post
    ...and happy optimizing!  Recommended Reading Issa, S. S., Shaimardanova, A. A., Solovyeva, V. V., & Rizvanov...Resources References Aschauer, D. F., Kreuz, S., & Rumpel, S. (2013). Analysis of Transduction Efficiency...10.1089/hum.2009.169 Dudek, A. M., Pillay, S., Puschnik, A. S., Nagamine, C. M., Cheng, F., Qiu, J., Carette... https://doi.org/10.1038/s41434-019-0075-6 Issa, S. S., Shaimardanova, A. A., Solovyeva, V. V., & Rizvanov...number of different cells. Promoters such as chicken-beta-actin or CAG can drive strong early gene expression...10.1371/journal.pone.0076310 Damdindorj, L., Karnan, S., Ota, A., Hossain, E., Konishi, Y., Hosokawa, Y.,...Fong, D. M., Mouravlev, A., Young, D., & O’Carroll, S. J. (2019). Astrocyte-selective AAV gene therapy through...

  20. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...190500 Homer1L/S scFv [L113/130] L113/130 scFv 2a Homer1L/S Mouse Mouse 190501 Homer1L/S scFv [L113/130...Gamma2L/S scFv [N452/73] N452/73 scFv 2T GABA(A)R, Gamma2L/S Human Mouse 190556 GABA(A)R, Gamma2L/S scFv ...Mouse IgG2a 114530 Anti-Neurexin-1-Beta [N170A/1.1R] Neurexin-1-Beta Human Mouse IgG2a 114533 Anti-Laforin...Mouse IgG2a 188207 Anti-Neurexin-1-Beta [N170A/26R] Neurexin-1-Beta Human Mouse IgG2a 188208 Anti-FGF13... 206659 Anti-Neurexin-1-Beta [N170A/1R-2b] Neurexin-1-Beta (staining) Human Mouse IgG2b 206660 Anti-Cav3.1...Mouse IgG1 206702 Anti-Neurexin-1-Beta [N170A/1R-1] Neurexin-1-Beta Human Mouse IgG1 206703 Anti-GFAP ...C-terminus Human Mouse IgG2a 220412 Beta-2 adrenergic receptor [N430/30R] Beta-2 adrenergic receptor Mouse Mouse...
Showing: 1 - 20 of 33 results