We narrowed to 4 results for: CRC
-
TypeBlog Post...RNA Nanotechnology and Therapeutics. Boca Raton: CRC Press, 2014. 5. Hayat, Akhtar and Marty, Jean L. ...
-
Plasmids 101: Common Lab E. coli Strains
TypeBlog Post... for uptake of foreign (methylated) DNA mrr, Δ(mcrC-mrr) Inactivation of pathway that cleaves methylated...glnV44 recA1 thi-1 gyrA96 relA1 lac Hte Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 tetR F'[proAB lacIqZΔM15 Tn10(TetR... -
Validated gRNA Sequences
TypeCollection...gRNA2CGGGATATCGGGTGGCGGCT 72626 cut S. pyogenes 26493208 Guigo, Johnson TCRC H. sapiens gRNA1:GGGGAGCGGGAAAGCGGTCG; gRNA2:AACTGACCTTCAGGCCCGTA... -
Optogenetics Guide
TypeGuide...reinhardtii (CrChR2) 470 ChR2/H134 Widely used variant with larger photocurrent compared to CrChR2 450 ChETA... Function Opsins. Mutations at C128 and D156 of CrChR delay the closing of the channel 470(activ.), 590...590(inact.) ReaChR Red-activatable variant of CrChR2 590 Channelrhodopsins: cation channels from other...chloride channels iChloC Chloride-conducting channel, CrChR2 with mutations E90R, D156N, T159C, CE83Q & E101S...