We narrowed to 21 results for: DsRed
-
TypeBlog Post...electroporation studies, DsRed reporter expression was induced in ~76% of GFP+ cells, and 100% of DsRed+ cells also...GFP, but commonly used red fluorescent proteins dsRed, mCherry, and TdTomato do not induce transcription...
-
Fluorescent Proteins 101: Fluorescent Protein Timers
TypeBlog Post...when Terskikh et al. reported the production of dsRed E5. This timer predictably transitions from green... in the developing pancreas by placing FP timer DsRed-E5 under the control of Neurog3 (a gene controlling... "An enhanced mutant of red fluorescent protein DsRed for double labeling and developmental timer of neural... -
When is a Monomer not a Monomer? The Top Three Ways Your Favorite Fluorescent Protein Oligomerizes in Cells
TypeBlog Post...EGFP) [1, 2] or even form obligate tetramers (i.e. DsRed) [3]. This is a problem for fusion proteins. One...as EGFP, but not for obligate oligomers such as DsRed or high affinity FPs such as TagRFP. Problem 3 can... -
Fluorescent Proteins 101: History of Fluorescent Proteins
TypeBlog Post...and he was able to report new fluorophores like DsRed from Discosoma sp. and Katushka/mKate from Entacmaea... -
Fluorescent Biosensors for Measuring Autophagic Flux
TypeBlog Post...cells. This decrease in pH quenches SEP but not DsRed, leading to emission of only red fluorescence. The...proteins: a relatively pH-insensitive RFP variant, DsRed.T3, that’s connected to a pH-sensitive GFP variant... -
Retrovirus Plasmids
TypeCollection...pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression plasmid; deletion of dsRed by Cre recombinase... recombinase results in the rapid loss of dsRed and the activation of your gene fused to eGFP expression... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection... RAB7 GFP Richard Pagano 12661 DsRed-rab7 WT Late endosomes RAB7 DsRed Richard Pagano 158006 pCMV-mGold-Lysosome-N...Rab11a GFP Richard Pagano 12679 DsRed-rab11 WT Recycling endosomes Rab11a DsRed Richard Pagano *Fusions to ...Rab5a TagBFP James Johnson 13050 DsRed-Rab5 WT Early endosomes RAB5A DsRed2 Richard Pagano 42307 GFP-EEA1... -
Rosella: A Fluorescent pH-Biosensor for Studying Autophagy
TypeBlog Post...C-terminus of DsRed.T3. See Table 1 for a summary of Rosella’s excitation and emission spectra. DsRed is the ...proteins: a relatively pH-insensitive RFP variant, DsRed.T3 and a pH-sensitive GFP variant, super ecliptic...spectra. Component Excitation Emission pH Range DsRed.T3 488, 543*, 568 nm 587 nm ~4.9 - 9 SEP ... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...an NLS from the CMV promoter pAdx-CMV-dsRed 73349 Expresses dsRed from the CMV promoter pAdx-CMV-iCre-p2A-copGFP... -
Which Fluorescent Protein Should I Use?
TypeBlog Post... 37°C, mCherry takes ~15min, TagRFP ~100min and DsRed ~10hours. Temperature: FPs maturation times and ... -
Fluorescent Proteins 101: Green Fluorescent Protein (GFP)
TypeBlog Post...GFP derivatives, but are instead related to the dsRed protein isolated from Discosoma sp. Similar work... -
The Fluorescent Vegetables in Aptamer Soup
TypeBlog Post...hydroxybenzylidene-imidazolinone-2-oxime (DFHO), a fluorophore modified from DsRed. DFHO shares many structural properties with DFHBI... -
27 Hot Plasmids from 2016
TypeBlog Post...dual colour-emission biosensor Rosella consists of DsRed connected to a pH-sensitive variant of GFP (SEP)...Figure 1). The key to the biosensor lies in pH: DsRed is relatively pH-insensitive, while SEP fluoresces...environments that inactivate SEP and leave only DsRed to fluoresce (1). With variants that can be targeted... -
CRISPR References and Information
TypeCollection...vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2) , human CD2 (pSIR-hCD2) PDF, 108...donor plasmid backbones pSL1180-HR-PUbECFP & pSL1180polyUBdsRED PDF, 597 KB Zhang gRNA cloning CRISPR RNA... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post...the induction of both DsRed fluorescence and GFP shRNA. Mice carrying the R26DsRedR; CRUSH-GFP; and Nestin-Cre...Timer protein - a mutant of the fluorescent protein dsRed that changes irreversibly its color from green to...clonogenic neural stem cells concomitant with activated DsRed2 expression. Brown et al., Genesis 2014 Jan;... -
Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins
TypeBlog Post...Yellow-orange fluorescent proteins like TagRFP, tdTomato, DsRed, the mKate series, or tdKatushka2 (Drobizhev et ... -
Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins
TypeBlog Post...PA-mRFP1(S146H / I161V / I197H) (3) were derived from DsRed and mRFP, respectively. When illuminated with violet... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Gateway cloning; includes tagging with ECFP, EYFP, DsRed, Cerulean Bacteria Gradia Lab Bacterial Vectors ...Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian Expression DsRed2-N1 - Mammalian Expression... Expression DsRed2-C1 - Mammalian Expression DsRed2-pBAD - Bacterial Expression mApple 568 592 37 6.5 ... -
Sequencing Primers
TypeGuide...primer DsRed1-C AGCTGGACATCACCTCCCACAACG (BD Biosciences) 3' end of DsRed1, forward primer DsRed1-N GTACTGGAACTGGGGGGACAG...GTACTGGAACTGGGGGGACAG (BD Biosciences) 5' end of DsRed1, reverse primer EBV Reverse GTGGTTTGTCCAAACTCATC... -
Neurodegeneration Plasmid Collection
TypeCollection...FUS Flag, His TRE ALS Zissimos Mourelatos 51146 DsRed-p150 217-548 DCTN1 CMV ALS Trina Schroer 51221 CMV-CC2... CMV Parkinson's Ted Dawson 17706 GLASTp-DsRed2 SLC1A3 DsRed2 Episodic ataxia Nicholas Gaiano 17797 pM-ErbB4CTF...