...lab, which includes pAAV-hSyn Con/Fon hChR2(H134R)-EYFP that is both Cre and Flp dependent. Plasmid Serotype...mScarlet-KV2.1 55645 AAV5 pAAV-hSyn Con/Fon hChR2(H134R)-EYFP 26975 AAVrg pAAV-CaMKIIa-hChR2(H134R)-mCherry ...H134R)-mCherry 26973 AAVrg pAAV-hSyn-hChR2(H134R)-EYFP   Control AAV Control AAV allow researchers to...Nuc-flox(mCherry)-EGFP 27056 AAVrg pAAV-Ef1a-DIO EYFP 50457 AAV2 pAAV-hSyn-DIO-EGFP   Biosensor AAV...pAAV-hSyn-DIO-mCherry 27056 AAVrg pAAV-Ef1a-DIO EYFP 114471 AAV5 pAAV-Ef1a-fDIO mCherry 112677 AAV2...

...Figure 1: Plasmid mix to label neuronal morphology (eYFP) and the synaptic protein PSD95 (PSD95-mcherry) ...expressing fluorescent cytoplasmic markers (e.g. eYFP) and synaptic proteins (e.g. postsynaptic PSD95-... Figure 2: Expression of a morphological marker (eYFP) and synaptic marker (PSD95-mcherry), under the ...

...to access them! Controls pAAV-hSyn-hChR2(H134R)-EYFP (26973-AAVrg) pAAV-hSyn-hChR2(H134R)-mCherry (26976...AAVrg) Optogenetics pAAV-hSyn Con/Fon hChR2(H134R)-EYFP (55645-AAV5)  Additional resources on the Addgene...

.... Mol Syst Biol. 2014 Galit Lahav EYFP Gateway vectors with EYFP split at 175 Arabidopsis homolog of...

...+ and other cations. B) Cortical slice of HcKCR1-EYFP and tdTomato expressed layer 2/3 neurons in mouse...

...Serotype Name Depositor 27056 AAVrg pAAV-Ef1a-DIO EYFP Karl Deisseroth 11447 AAV5 pAAV-Ef1a-fDIO mCherry...

...ChETA-EYFP EF1a ChETA EYFP Cre dependent 1, 5, 9 Deisseroth 35497 pAAV-Ef1a-DIO C1V1 (t/t)-TS-EYFP EF1a...t/t) EYFP Cre dependent 9 Deisseroth 35499 pAAV-CaMKIIa-C1V1 (t/t)-TS-EYFP CaMKII C1V1 (t/t) EYFP Constitutive...Arch3.3-EYFP nEF Arch3.3 EYFP Cre dependent 8 Deisseroth 137150 pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP nEF Arch3.3...floxed-eNpHR-EYFP-WPRE-pA EF1a eNpHR EYFP Cre dependent 9 Deisseroth 26966 AAV-Ef1a-DIO eNpHR 3.0-EYFP EF1a eNpHR...3.0 EYFP Constitutive 1, 9 Deisseroth 26972 pAAV-hSyn-eNpHR 3.0-EYFP Syn eNpHR 3.0 EYFP Constitutive 5 Deisseroth...pAAV-nEF-NpHR3.3-EYFP nEF NpHR 3.3 EYFP Constitutive 8 Deisseroth 137152 pAAV-nEF-Con/Fon-NpHR3.3-EYFP nEF NpHR...3.3 EYFP Cre dependent 8 Deisseroth 137154 pAAV-nEF-Coff/Fon-NpHR3.3-EYFP nEF NpHR 3.3 EYFP Flp dependent...

...-fDIO EYFP Flp 55640 pAAV-Ef1a-dDIO hChR2(H134R)-EYFP Dre 55639 pAAV-Ef1a-fDIO hChR2(H134R)-EYFP Flp 126080...proof-of-concept targeting approach in 2014 1 (using EYFP and ChR2-EYFP as payloads). This approach has been broadly...mouse and rat lines. Plasmids In addition to EYFP and ChR2-EYFP, a large number of additional, validated ...pAAV-Ef1a-sCreDIO hChR2(H134R)-eYFP Scre 126081 pAAV-Ef1a-vCreDIO hChR2(H134R)-eYFP Vcre Dual recombinase-dependent...Mutations 55650 pAAV-hSyn Con/Fon EYFP Cre AND Flp 55651 pAAV-hSyn Con/Foff EYFP Cre AND NOT Flp F3/F5 137162...pAAV-Ef1a-Con/Foff 2.0-EYFP Cre AND NOT Flp FRT/F5 55652 pAAV-hSyn Coff/Fon EYFP Flp AND NOT Cre 137129... Con/Fon hChR2(H134R)-EYFP Cre AND Flp 55644 pAAV-nEF Con/Fon hChR2(H134R)-EYFP Cre AND Flp 55647 pAAV-nEF...

...Foff 2.0-EYFP EF1a EYFP Cre dependent 8 Deisseroth 137164 pAAV-nEF-Con/Fon/Von eYFP nEF EYFP Cre, Flp ... EGFP Constitutive 5 Haydon 104055 pAAV-CAG-eYFP CAG EYFP Constitutive 2, 5, rg*, PHP.eB Gradinaru 104061... 1, 2, 5, 8, 9, rg* Deisseroth 117382 hSyn1-eYFP hSyn eYFP Constitutive 5, 8, 9, rg*, PHP.eB Gradinaru...Cre-dependent expression 27056 pAAV-Ef1a-DIO EYFP EF1a EYFP Cre dependent 1, 2, 5, 9, rg* Deisseroth 28306... dependent 1 Wickersham 104052 pAAV-CAG-DIO-EYFP CAG EYFP Cre dependent PHP.V1 Gradinaru 83895 pAAV-hDlx-Flex-GFP-Fishell..., 8, 9, rg* Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP Flp dependent 1, 2, 9 Deisseroth 128434 pAAV-Ef1a-fDIO-tdTomato...INTRSECT Constructs 55650 pAAV-hSyn Con/Fon EYFP hSyn EYFP Cre and Flp dependent 8, rg* Deisseroth 137129...

...pAAV-Ef1a-DIO ChETA-EYFP Karl Deisseroth AV-1-26969P 26969-AAV1 pAAV-CaMKIIa-hChR2(H134R)-EYFP Karl Deisseroth...pAAV-CaMKIIa-eNpHR 3.0-EYFP Karl Deisseroth AV-1-26973P 26973-AAV1 pAAV-hSyn-hChR2(H134R)-EYFP Karl Deisseroth...pAAV-Ef1a-DIO eNpHR 3.0-EYFP Karl Deisseroth AV-5-26968P 26968-AAV5 pAAV-Ef1a-DIO ChETA-EYFP Karl Deisseroth ...pAAV-CaMKIIa-hChR2(H134R)-EYFP Karl Deisseroth AV-5-26972P 26972-AAV5 pAAV-hSyn-eNpHR 3.0-EYFP Karl Deisseroth ...floxed-eNpHR-EYFP-WPRE-pA Karl Deisseroth AV-9-26966P 26966-AAV9 pAAV-Ef1a-DIO eNpHR 3.0-EYFP Karl Deisseroth...pAAV-CaMKIIa-hChR2(H134R)-EYFP Karl Deisseroth AV-9-26971P 26971-AAV9 pAAV-CaMKIIa-eNpHR 3.0-EYFP Karl Deisseroth...pAAV-CaMKIIa-C1V1 (t/t)-TS-EYFP Karl Deisseroth AV-9-35505 35505-AAV9 pAAV-CaMKIIa-hChR2(E123A)-EYFP Karl Deisseroth...

...-CAG-DIO-EYFP An AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the...AAV2 pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...AAVrg pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...PHPeB pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...Boyden 117382-AAV2 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter...Gradinaru 117382-AAV5 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter...Gradinaru 117382-AAV8 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter...

...Fon/Von eYFP nEF EYFP, Cre, Flp and VCre-dependent Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control...Cre-dependent Control Roth 55650 pAAV-hSyn Con/Fon EYFP Syn EYFP, Cre and Flp-dependent Control Deisseroth 28306...Cre-dependent Control Boyden 27056 pAAV-Ef1a-DIO EYFP EF1a EYFP, Cre-dependent Control Deisseroth 114470 pAAV-Ef1a-mCherry...Dlx dTomato Control Fishell 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 112677 pOTTC1032 - pAAV EF1a... 3.0-EYFP EF1a Inhibitor, Cre-dependent Optogenetics Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn ...Deisseroth 20298 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA EF1a Activator, Cre-dependent Optogenetics... Deisseroth 55645 pAAV-hSyn Con/Fon hChR2(H134R)-EYFP Syn Activator, Cre and Flp-dependent Optogenetics...

... EYFP connected by 8 GGSGGS repeats pET28CLY9 Peptide linker standard consisting of ECFP and EYFP connected...pET28CLY1 Peptide linker standard consisting of ECFP and EYFP connected by 1 flexible glycine- and serine-containing...pET28CLY2 Peptide linker standard consisting of ECFP and EYFP connected by 2 GGSGGS repeats pET28CLY3 Peptide ...Peptide linker standard consisting of ECFP and EYFP connected by 3 GGSGGS repeats pET28CLY4 Peptide linker standard... standard consisting of ECFP and EYFP connected by 4 GGSGGS repeats pET28CLY5 Peptide linker standard ...standard consisting of ECFP and EYFP connected by 5 GGSGGS repeats pET28CLY6 Peptide linker standard consisting...consisting of ECFP and EYFP connected by 6 GGSGGS repeats pET28CLY7 Peptide linker standard consisting of ECFP...

...Dlx mRuby2 Control Gradinaru 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP...EF1a mCherry Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control Gradinaru 135630 pAAV-S5E2-dTom-nlsdTom...pAAV-hSyn-hChR2(H134R)-EYFP Syn Activator ChR2 Deisseroth 20298 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA...-ChR2(H134R)-eYFP CAG Activator, Cre-dependent ChR2 Gradinaru 135633 pAAV-S5E2-C1V1-eYFP E2 regulatory...Description Category PI 104052 pAAV-CAG-DIO-EYFP CAG EYFP, Cre-dependent Control Gradinaru MaCPNS1 These...

...Mutations Relative to Wildtype GFP EGFP F64L; S65T EYFP S65G; V68L; S72A; T203Y mYFP S65G; V68L; Q69K;...

...syn-FLEX-axon-jYCaMP1s. Find these AAVs at Addgene Cre-dependent EYFP AAV in the new serotype PHP.V1 that exhibits efficient...

...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1 Gradinaru...

...Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-F GTGGACTCTTGTTCCAAACTGG F1...

...Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-F GTGGACTCTTGTTCCAAACTGG F1...

... 21741 Clathrin-LCa-EYFP Clathrin-coated vesicles Clathrin, light polypeptide EYFP Xiaowei Zhuang 14437...