Skip to main content

We narrowed to 27 results for: EYFP

Showing: 1 - 20 of 27 results
  1. New and Upcoming Viral Vectors - December 2019

    Type
    Blog Post
    ...lab, which includes pAAV-hSyn Con/Fon hChR2(H134R)-EYFP that is both Cre and Flp dependent. Plasmid Serotype...mScarlet-KV2.1 55645 AAV5 pAAV-hSyn Con/Fon hChR2(H134R)-EYFP 26975 AAVrg pAAV-CaMKIIa-hChR2(H134R)-mCherry ...H134R)-mCherry 26973 AAVrg pAAV-hSyn-hChR2(H134R)-EYFP   Control AAV Control AAV allow researchers to...Nuc-flox(mCherry)-EGFP 27056 AAVrg pAAV-Ef1a-DIO EYFP 50457 AAV2 pAAV-hSyn-DIO-EGFP   Biosensor AAV...pAAV-hSyn-DIO-mCherry 27056 AAVrg pAAV-Ef1a-DIO EYFP 114471 AAV5 pAAV-Ef1a-fDIO mCherry 112677 AAV2...
  2. New Viral Vectors - Winter 2025

    Type
    Blog Post
    ...Biosensor Marianne Fyhn New viral prep pAAV-Ef1a-fDIO EYFP AAV5. AAV8, AAVrg Control Karl Deisseroth New ... AiP13755: pAAV-AiE0743m_3xC2-minBG-ChR2(H134R)-EYFP-WPRE3-BGHpA (Alias: CN3755) AAV-PHPeB Optogenetics...
  3. Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View

    Type
    Blog Post
    ...Figure 1: Plasmid mix to label neuronal morphology (eYFP) and the synaptic protein PSD95 (PSD95-mcherry) ...expressing fluorescent cytoplasmic markers (e.g. eYFP) and synaptic proteins (e.g. postsynaptic PSD95-... Figure 2: Expression of a morphological marker (eYFP) and synaptic marker (PSD95-mcherry), under the ...
  4. New and Upcoming Viral Vectors - September 2019

    Type
    Blog Post
    ...to access them! Controls pAAV-hSyn-hChR2(H134R)-EYFP (26973-AAVrg) pAAV-hSyn-hChR2(H134R)-mCherry (26976...AAVrg) Optogenetics pAAV-hSyn Con/Fon hChR2(H134R)-EYFP (55645-AAV5)  Additional resources on the Addgene...
  5. New Viral Vectors - Spring 2025

    Type
    Blog Post
    ...Yizhar New viral tool pAAV-Ef1a-fDIO hChR2(H134R)-EYFP AAVrg Optogenetics Karl Deisseroth New viral tool...
  6. New Viral Vectors - Fall 2024

    Type
    Blog Post
    ...Deisseroth New serotype pAAV-hSyn-hChR2(H134R)-EYFP AAV2 Optogenetics Karl Deisseroth New serotype ...
  7. Hot Plasmids - October 2022

    Type
    Blog Post
    ...+ and other cations. B) Cortical slice of HcKCR1-EYFP and tdTomato expressed layer 2/3 neurons in mouse...
  8. Optogenetics AAV Preps

    Type
    Collection
    ...TC)-EYFP nEF ChR2(E123T/T159C) EYFP Flp dependent 8 Karl Deisseroth 26968 pAAV-Ef1a-DIO ChETA-EYFP EF1a...Fon-Arch3.3-p2a-EYFP nEF Arch3.3 EYFP Flp dependent 8 Karl Deisseroth 20949 pAAV-double floxed-eNpHR-EYFP-WPRE-pA...eNpHR EYFP Cre dependent 9 Karl Deisseroth 26966 AAV-Ef1a-DIO eNpHR 3.0-EYFP EF1a eNpHR 3.0 EYFP Cre dependent... 3.0-EYFP CaMKII eNpHR 3.0 EYFP Constitutive 1, 9 Karl Deisseroth 26972 pAAV-hSyn-eNpHR 3.0-EYFP Syn eNpHR...eNpHR 3.0 EYFP Constitutive 2, 5 Karl Deisseroth 137151 pAAV-nEF-NpHR3.3-EYFP nEF NpHR 3.3 EYFP Constitutive...NpHR3.3-EYFP nEF NpHR 3.3 EYFP Cre dependent 8 Karl Deisseroth 137154 pAAV-nEF-Coff/Fon-NpHR3.3-EYFP nEF ....0-iC++-EYFP nEF iC++ EYFP Cre dependent 8 Karl Deisseroth 137157 pAAV-nEF-Coff/Fon-iC++-EYFP nEF iC++...
  9. Hot Plasmids - August 2020

    Type
    Blog Post
    ...syn-FLEX-axon-jYCaMP1s. Find these AAVs at Addgene Cre-dependent EYFP AAV in the new serotype PHP.V1 that exhibits efficient...
  10. Deisseroth INTRSECT Collection

    Type
    Collection
    ...proof-of-concept targeting approach in 2014 1 (using EYFP and ChR2-EYFP as payloads). This approach has been broadly...constructs experimentally. Plasmids In addition to EYFP and ChR2-EYFP, a large number of additional, validated ...Items 55641 pAAV-Ef1a-fDIO EYFP Flp Yes 55640 pAAV-Ef1a-dDIO hChR2(H134R)-EYFP Dre No 55639 pAAV-Ef1a-fDIO...pAAV-Ef1a-fDIO hChR2(H134R)-EYFP Flp Yes 126080 pAAV-Ef1a-sCreDIO hChR2(H134R)-eYFP Scre No 126081 pAAV-Ef1a-vCreDIO...Items 55650 pAAV-hSyn Con/Fon EYFP Cre AND Flp Yes 231926 pAAV-Ef1a-Con/Fon-EYFP Cre AND Flp No 55651 pAAV-hSyn...pAAV-hSyn Con/Foff EYFP Cre AND NOT Flp F3/F5 No 137162 pAAV-Ef1a-Con/Foff 2.0-EYFP Cre AND NOT Flp FRT/...55652 pAAV-hSyn Coff/Fon EYFP Flp AND NOT Cre No 231927 pAAV-Ef1a-Coff/Fon-EYFP Flp AND NOT Cre Yes 137129...
  11. Control AAV Preps

    Type
    Collection
    ...Edward Boyden 59133 pOTTC589 - pAAV c-fos Nuc-eYFP c-Fos EYFP Constitutive 1 Brandon Harvey 59462 pAAV-CAG-tdTomato...Constitutive 5 Philip Haydon 104055 pAAV-CAG-eYFP CAG EYFP Constitutive 2, 5, rg*, PHP.eB Viviana Gradinaru..., 5, 8, 9, rg* Karl Deisseroth 117382 hSyn1-eYFP hSyn eYFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Viviana...dependent 9 Karl Deisseroth 27056 pAAV-Ef1a-DIO EYFP EF1a EYFP Cre dependent 1, 2, 5, 9, rg* Karl Deisseroth...dependent 1 Ian Wickersham 104052 pAAV-CAG-DIO-EYFP CAG EYFP Cre dependent PHP.V1 Viviana Gradinaru 83895...Karl Deisseroth 137162 pAAV-Ef1a-Con/Foff 2.0-EYFP EF1a EYFP Cre dependent 8 Karl Deisseroth 98927 pENN....9, rg* Karl Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP Flp dependent 1, 2, 5, 8, 9, rg* Karl Deisseroth...
  12. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-1-26971P 26971-AAV1 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics...eNpHR 3.0-EYFP Optogenetics Karl Deisseroth AV-5-26968P 26968-AAV5 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-5-26972P 26972-AAV5 pAAV-hSyn-eNpHR 3.0-EYFP Optogenetics...floxed-eNpHR-EYFP-WPRE-pA Optogenetics Karl Deisseroth AV-9-26966P 26966-AAV9 pAAV-Ef1a-DIO eNpHR 3.0-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-9-26971P 26971-AAV9 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics...t/t)-TS-EYFP Optogenetics Karl Deisseroth AV-9-35505 35505-AAV9 pAAV-CaMKIIa-hChR2(E123A)-EYFP Optogenetics...E123A)-EYFP Optogenetics Karl Deisseroth AV-9-35509 35509-AAV9 pAAV-Ef1a-DIO hChR2(E123T/T159C)-EYFP Optogenetics...
  13. Brain Initiative Collection

    Type
    Collection
    ...-CAG-DIO-EYFP An AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the...AAV2 pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...AAV5 pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...AAVrg pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...PHPeB pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...Boyden 117382-AAV2 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter...Gradinaru 117382-AAV5 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter...
  14. Retrograde AAV viral preps

    Type
    Collection
    ...pAAV-Ef1a-DIO EYFP EF1a EYFP, Cre-dependent Control Karl Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP, Flp-dependent...Von eYFP nEF EYFP, Cre, Flp and VCre-dependent Control Karl Deisseroth 117382 hSyn1-eYFP Syn EYFP Control... Control Bryan Roth 55650 pAAV-hSyn Con/Fon EYFP Syn EYFP, Cre and Flp-dependent Control Karl Deisseroth...dTomato Control Gordon Fishell 104055 pAAV-CAG-eYFP CAG EYFP Control Viviana Gradinaru 112677 pOTTC1032 -...H134R)-EYFP EF1a Activator Optogenetics Karl Deisseroth 55645 pAAV-hSyn Con/Fon hChR2(H134R)-EYFP Syn Activator...Deisseroth 20298 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA EF1a Activator, Cre-dependent Optogenetics...Optogenetics Karl Deisseroth 26966 pAAV-Ef1a-DIO eNpHR 3.0-EYFP EF1a Inhibitor, Cre-dependent Optogenetics Karl ...
  15. Caltech Systemic Capsids

    Type
    Collection
    ...Dlx mRuby2 Control Gradinaru 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP...EF1a mCherry Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control Gradinaru 135630 pAAV-S5E2-dTom-nlsdTom...pAAV-hSyn-hChR2(H134R)-EYFP Syn Activator ChR2 Deisseroth 20298 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA...-ChR2(H134R)-eYFP CAG Activator, Cre-dependent ChR2 Gradinaru 135633 pAAV-S5E2-C1V1-eYFP E2 regulatory...Description Category PI 104052 pAAV-CAG-DIO-EYFP CAG EYFP, Cre-dependent Control Gradinaru MaCPNS1 These...214846 AiP13755: pAAV-AiE0743m_3xC2-minBG-ChR2(H134R)-EYFP-WPRE3-BGHpA (Alias: CN3755) minBG Activator ChR2...
  16. AAV Molecular Tools

    Type
    Collection
    ...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP. 1 Viviana...
  17. Sequencing Primers

    Type
    Guide
    ...GTCTTGTAGTTGCCGTCGTC For distinguishing EGFP vs ECFP vs EYFP Reverse F1ori-F GTGGACTCTTGTTCCAAACTGG F1 origin...
Showing: 1 - 20 of 27 results