We narrowed to 27 results for: PUR ALPHA-1

...DEFA1 defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin, alpha 3, neutrophil-specific... 3 G0S19-1, LD78ALPHA, MIP-1-alpha, MIP1A, SCYA3 CCL3L1 chemokine (C-C motif) ligand 3-like 1 464.2, D17S1718...IGHDY1 IGHD1-1 immunoglobulin heavy diversity 1-1 IGHD11 IGHD1-14 immunoglobulin heavy diversity 1-14 (non-...IGHV6-1 immunoglobulin heavy variable 6-1 IGHV61, VH IGHV7-4-1 immunoglobulin heavy variable 7-4-1 IGHV7...interferon, alpha 10 MGC119878, MGC119879 IFNA13 interferon, alpha 13 - IFNA14 interferon, alpha 14 LEIF2H...interferon, alpha 16 - IFNA17 interferon, alpha 17 IFNA, INFA, LEIF2C1 IFNA2 interferon, alpha 2 IFNA, INFA2...

...Anthony Brown 11908 pEGFP-N1 alpha-actinin 1 Actin filaments alpha-Actinin 1 EGFP Carol Otey 27676 Cortactin-pmCherryC1...Huttenlocher 11908 pEGFP-N1 alpha-actinin 1 Focal adhesions alpha-Actinin 1 EGFP Carol Otey 31923 pPaxillin-PSmOrange...Microtubules alpha-Tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-Tubulin...Microtubules alpha-Tubulin mTurquoise2 Dorus Gadella 85045 pmScarlet_alphaTubulin_C1 Microtubules alpha-Tubulin...cycle) PICH EGFP Erich Nigg 49149 mCh-alpha-Tubulin Microtubules alpha-Tubulin mCherry Gia Voeltz 118084 ...Microtubules alpha-Tubulin mGold2t Francois St-Pierre 231771 pCMV-mGold2s-Tubulin-C-18 Microtubules alpha-Tubulin...Microtubules alpha-Tubulin mClover3 Michael Lin 74256 pKanCMV-mRuby3-18aa-Tubulin Microtubules alpha-Tubulin...

...transcription factors such as PAX7, PAX6, AP-2 alpha and ISLET-1. In addition, we distribute monoclonal antibodies...Monoclonal Antibody Research Institute dedicated to: 1) developing new ways of generating antibodies, for...proteins of interest for labeling, quantification, purification, chromatin immunoprecipitation and more. The...

...His, V5 EF-1 alpha Parkinson's Mark Cookson 25081 pDEST51-LRRK2-R1441C LRRK2 His, V5 EF-1 alpha Parkinson's...His, V5 EF-1 alpha Parkinson's Mark Cookson 25083 pDEST51-LRRK2-R1441H LRRK2 His, V5 EF-1 alpha Parkinson's...His, V5 EF-1 alpha Parkinson's Mark Cookson 29398 pDEST51-LRRK2-R1398Q LRRK2 His, V5 EF-1 alpha Parkinson's...His, V5 EF-1 alpha Parkinson's Mark Cookson 29400 pDEST51-LRRK2-T1343G LRRK2 His, V5 EF-1 alpha Parkinson's...307-SOD1WT SOD1 EF-1 alpha ALS Mohan Babu 83445 pLEX_307-SOD1E133delta SOD1 EF-1 alpha ALS Mohan Babu 83446...SOD1E133insTT SOD1 EF-1 alpha ALS Mohan Babu 83447 pLEX_307-SOD1E133K SOD1 EF-1 alpha ALS Mohan Babu 84347...-NE SNCA NE EF-1 alpha Parkinson's Shu Leong Ho 102366 pSIN-hSNCA-NE SNCA NE EF-1 alpha Parkinson's Shu...

... of mechanotransduction receptors, comprised of alpha-beta subunit heterodimers. The IPI collection contains...contains antibodies that uniquely: Bind to the alpha subunit, outside the ligand-binding pocket Bind to...and interrogate with conventional reagents. Figure 1: Axon guidance cues and receptors regulate the development...antibodies that recognize common epitope tags to help purify, detect, or localize particular proteins. Browse...

...FLPe from the EF-1 promoter pCDH-EF1-copGFP-T2A-Puro 72263 Express copGFP and the puromycin resistance gene...against mouse TNF-alpha mRNA from the mouse U6 promoter pCDH-EF1-Nluc-P2A-copGFP-T2A-Puro 73022 Expresses...Lentiviral Vector ID Purpose pCDH-EF1-DIO-copGFP 72253 Expresses copGFP under EF-1 promoter when Cre is...under EF-1 promoter when Cre is expressed by another vector pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 Cre...pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from...72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2-P2A-copGFP 72485 Expresses ...pCDH-CB-FLPe-P2A-copGFP-T2A-Puro 72258 Expresses FLPe, copGFP and the puromycin resistance from the CB promoter...

... We now have another model of Cas9 – a flexible alpha-carbon backbone model made of nylon – that more ... – a mechanical device that could be used to bend 1/8th inch steel wire into a backbone structure of a...BioMolecular Modeling (CBM) in 1999 with the expressed purpose of creating physical models of proteins and other...

...10.1038/s41551-024-01227-1. doi:  https://doi.org/10.1038/s41551-024-01227-1   CHARM: A compact epigenetic...with a GFP nanobody (Figure 1). This enrichment streamlines the purification and minimizes sample loss ...peptides (3HB: 11-nm 3-helix bundle; SAH: 60-nm single alpha helix) and target capture module (SpyTag-GFP nanobody...highly-visible beads on the cryo-EM grid.     Figure 1: MagIC-cryo-EM for sample enrichment and structure...single-particle analysis of PRC2 with RvLEAMshort (1:6 molar ratio) with 10 minutes of glutaraldehyde crosslinking...protocols typically require high concentration and purity of the target molecule, which can be problematic...

...successfully generated several functional heterotrimeric G-alpha subunit fusions that do not tolerate N- and C-terminal... remains fluorescent in acidic organelles (Figure 1), showing that its acid tolerance is maintained in...follow him on twitter: @joachimgoedhart.   References 1. Zacharias, David A., et al. "Partitioning of lipid-modified...vitro by measuring the fluorescence intensity of purified protein at different acid concentrations. Overviews...

...coexpression. Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid with puromycin selection. See plasmid ...for hygromycin selection. Bob Weinberg 10878 pLKO.1 – TRC cloning plasmid 3rd U6-driven shRNA empty plasmid...Diane Mathis 21915 Tet-pLKO-puro 3rd Inducible expression of shRNA with puromycin selection. See plasmid 21916...Eric Campeau 39481 pLenti-puro 3rd CMV-driven expression of cDNA with puromycin selection. Ie-Ming Shih ...pBOB-EF1-FastFUCCI-Puro 3rd Encodes FUCCI reporters for cell cycle analysis. Puromycin selection. Kevin ...17448 pLenti CMV GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin selection. See Campeau...

...Methyltransferase 3 Alpha (DNMT3A) Vlatka Zoldoš’ lab has deposited pdCas9-DNMT3A-EGFP and pdCas9-DNMT3A-PuroR for targeted...well as pLV-dCas9-p300-P2A-PuroR for lentiviral expression. Figure 1: dCas9-p300 adds H3K27ac marks...lentiviral transduction. Lysine-specific Demethylase 1 (LSD1) Tatjana Sauka-Spengler's lab has deposited ...CRISPR, and Addgene has a number of tools for this purpose. Epigenetics began as a correlative field in which...mammalian cells. Co-expression markers EGFP and PuroR enable sorting and selection of transduced cells..., Korać P, Julg B, Klasić M, Zoldoš V (2016) Repurposing the CRISPR-Cas9 system for targeted DNA methylation...

...Thorel, F., et al., Conversion of adult pancreatic alpha-cells to beta-cells after extreme beta-cell loss...type of choice in vitro is known as reprogramming [1]. The process can be divided into two stages: Dedifferentiation...//www.linkedin.com/in/kmukherjeephd/.  References 1. Hochedlinger, K. and R. Jaenisch, Nuclear reprogramming...from human peripheral blood. Cell Stem Cell, 2010. 7(1): p. 15-9. PubMed PMID: 20621044. PubMed Central PMCID...induced pluripotent stem cells. Hepatology, 2010. 51(1): p. 297-305. PubMed PMID: 19998274. PubMed Central... pluripotent stem cells. Nat Biotechnol, 2014. 32(1): p. 84-91. PubMed PMID: 24291815. PubMed Central ...keratinocyte lineage. Methods Mol Biol, 2014. 1195: p. 1-12. PubMed PMID: 24510784. PubMed Central PMCID: PMC4096605...

...al. Neuron. 2010) Express EGFP-tagged wt and mt Alpha-synuclein . (Furlong et al. Biochem J. 2000) See...one of three different inherited genes: Presenilin 1, Presenilin 2, and APP. The majority (> 90%) of individuals...Includes antibodies, viral vectors, animal models, purified protein, and more. Plasmids provided by the foundation...

...Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC Alpha factor signal sequence Forward... Reverse XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer/promoter Forward Xpress Forward TATGGCTAGCATGACTGGT...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse...pBAD-R Reverse Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT...GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus...

...concentration of puromycin should be from 1-10 μg/mL in 1 μg/mL increments. d. Label plates from 1-10 and add...of Contents A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium A.2 Map of pLKO.1 A.3 Related plasmids...Order oligos compatible with pLKO.1 C. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing... References H.1 Published articles H.2 Web resources I. Appendix I.1 Sequence of pLKO.1 TRC-Cloning Vector...information Back to Top A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium The pLKO.1 cloning vector is the backbone...Appendix I.1. Sequence of pLKO.1 TRC-Cloning Vector Click here to see the sequence of pLKO.1 TRC-cloning...the puromycin resistance marker encoded in pLKO.1 allows for convenient stable selection. Figure 1 : Map...

...been used for a variety of experimental purposes including (1) single or multiple, constitutive or inducible...Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin Early Endosome Vacuolar Compartment...light-sensitive LOV2 domain of Avena Sativa phototropin 1 (AsLOV2). In the dark, this peptide is caged by the...iLID nano and 800nM to 47µM for iLID micro; Figure 1). With this great affinity range, these LIDs have ...Figure 2). They are all available now at Addgene. 1 Lungu et al., Chem Biol. 2012 Apr 20;19(4):507-17....Guntas et al., Proc Natl Acad Sci USA 2015 Jan 6; 112(1):112-7. doi: 10.1073/pnas. CRISPR-Cas9 optogenetic... al., BMC Molecular Biology. 2013 August 20th; 14(1). TRICK: A method for visualizing the first round...

...disadvantages: Table 1 (Joglekar et al., 2017)  Table 1 (Gutierrez-Guerrero et al., 2020) Table 1 (Cronin et al...polyA tail.   Figure 1: Lentiviral production uses three plasmids: (1) The transfer plasmid, (2)...that can be used for specific purposes as described previously (Table 1, Gutierrez-Guerrero, et al, 2020...in cell lines expressing galactosyl(alpha1-3)galactosyl (alphaGal) sugars were less stable than viruses...express these sugars. (Takeuchi et al., 1997). The alphaGal sugars end up in the envelope and are targets ...targets for complement-based killing by anti-alphaGal antibodies. The VSV-G envelope protein is inactivated ..., and spumaviruses to human serum by galactosyl(alpha1-3)galactosylation. Journal of virology 71:6174–...

...Table 1 below outlines a few of the more common genetic changes found in E. coli strains. Table 1: Common...amber (UAG) stop codon by tyrosine insertion λ-thi-1 or thi1 Mutation in thiamine metabolism Requires exogenous... all based on E. coli K-12 and are considered BSL-1. Table 2: Lab strains of E. coli Strain Natural...plasmids, blue/white screening. F- endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF...) recA13 leuB6 ara-14 proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20(SmR) glnV44 λ- JM109   General cloning and...strain for cloning repetitive DNA. endA1 glnV44 thi-1 relA1 gyrA96 recA1 mcrB+ Δ(lac-proAB) e14- [F' traD36...of an E. coli K-12 strain. F- λ- ilvG- rfb-50 rph-1 NEB Stable   For cloning into and storage of lentiviral...

...-fDIO mCherry 83900 AAVrg pAAV-mDlx-GFP-Fishell-1 Biosensors Plasmid Serotype Name 83899 AAVrg...pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-IRES-Puro: Expression of the SARS-CoV-2 N protein  pLVX-EF1alpha-SARS-CoV...2xStrep-IRES-Puro: Expression of the SARS-CoV-2 M protein pLVX-EF1alpha-SARS-CoV-2-orf3a-2xStrep-IRES-Puro: Expression...the E protein (pLVX-EF1alpha-SARS-CoV-2-E-2xStrep-IRES-Puro) and NSP2 (pLVX-EF1alpha-SARS-CoV-2-nsp2-2xStrep-IRES-Puro...2xStrep-IRES-Puro) are also in the works in and should be come available in the next few weeks. CRISPRi...

...you can transform 1-2μl of your ligation reaction into competent cells such as DH5alpha or TOP10. If using...well, so let’s go over the details step-by-step. 1. Digestion Set up restriction digests for your insert...recipient plasmid : insert ratio” of approximately 1:3. Since the number of base pairs for each varies,...at minimum, two transformations after a ligation: 1. Control Transformation containing the ligation mixture...result in few colonies on both plates (unsuccessful 1), in a vector alone plate with many more colonies ...them. An easy way to do this is gel purification. In gel purification, you use a voltage difference across...the eyes and skin. When running a gel for purification purposes it is important to have nice crisp bands...