We narrowed to 139 results for: THY-2
-
TypeBlog Post...about the role of methylation (Hrit et al. 2018, Kaas et al. 2013). Figure 2: CRISPR TET-based...CRISPR-based approach for targeted DNA demethylation. Cell Discov 2, 16009. https://doi.org/10.1038/celldisc...cause demethylation? Dividing cells depend on DNA methyltransferase 1 (DNMT1) to copy methylation marks... proteins are not demethylases; they are dioxygenases that oxidize 5-methylcytosine to create rare DNA...complete DNA demethylation can be achieved by dCas9 alone, without TET (or any demethylase) fusion. This...site. So, when DNMT1 methylates the genome during DNA replication, it doesn’t methylate sites blocked by ...the original methylated strand is diluted to undetectable amounts: ergo, DNA demethylation! With optimization...
-
Plasmids 101: Methylation and Restriction Enzymes
TypeBlog Post...as depicted in Lane 2. Controlling methylation Finally, you can control methylation by altering your choice... Dcm methylase adds a methyl group to the second cytosine of CCWGG EcoKI methylase adds a methyl group...contain 3 methylases that recognize and methylate different stretches of DNA: Dam methylase adds a methyl...information. Enzyme Dam methylation Dcm methylation EcoKI methylation ApaI Not affected Blocked ...questions is the same--methylation! Read on to learn about how DNA methylation may affect your restriction...The other component of these systems, methyltransferases, methylate DNA at particular sequences to prevent...restriction modification systems containing methyltransferases that add methyl groups to specific DNA sequences ... -
Immunology Research Plasmids and Resources
TypeCollection...immunoglobulin heavy diversity 2-15 D2, IGHD215 IGHD2-2 immunoglobulin heavy diversity 2-2 IGHD22 IGHD2-21 immunoglobulin...heat shock 70kDa protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, ...variable 2-33 (non-functional) IGLV233, V1-9 IGLV2-8 immunoglobulin lambda variable 2-8 IGLV28, V1-2 IGLV3...beta 4 DEFB-2, DEFB102, DEFB2, HBD-2, SAP1 EDN1 endothelin 1 ET1, HDLCQ7 EDN2 endothelin 2 ET2, PPET2 ...receptor subfamily 2, group C, member 1 TR2 NR2C2 nuclear receptor subfamily 2, group C, member 2 TAK1, TR2R1...suppression of tumorigenicity 2 - STC1 stanniocalcin 1 STC STC2 stanniocalcin 2 STC-2, STCRP TAC1 tachykinin,...PTHR1 PTH2 parathyroid hormone 2 TIP39 PTH2R parathyroid hormone 2 receptor PTHR2 PTHLH parathyroid hormone-like... -
COVID-19 Resources
TypeCollection...page: SARS-CoV-2 Antibodies : Recombinant monoclonal antibodies that target SARS-CoV-2 nucleocapsid protein...protein. SARS-CoV-2 Plasmids : Plasmids that are available or coming soon containing SARS-CoV-2 sequences. SARS-CoV... targeting the SARS-CoV-2 nucleocapsid protein (Brian Geiss). Anti-SARS-CoV-2 Nucleocapsid Protein [mBG86...targeting the SARS-CoV-2 nucleocapsid protein (Brian Geiss). Plasmids SARS-CoV-2 Plasmids Many plasmids...SARS-CoV-2 plasmids are curated on a separate Ginkgo Bioworks Plasmid Collection page. SARS-CoV-2 Pooled...Converting Enzyme 2) is the host cell receptor mediating the entry of SARS-CoV and SARS-CoV-2 viruses. ( 1 ...that primes the SARS-CoV-2 S protein and is involved in virus entry into cells. ( 2 ) FURIN - an enzyme that... -
Trimmer Lab NeuroMab Collection
TypeCollection...FHF2 Human Mouse IgG2a 114527 Anti-JIP-2/IB-2 [N135/37.2R] JIP-2/IB-2 Mouse Mouse IgG2a 114529 Anti-Pan-SAPAP...Anti-CDY1/2/L1/L2 [N143/36R] CDY1/2/L1/L2 Human Mouse IgG2a 206535 Anti-CDY1/2 [N143/38R] CDY1/2 Human Mouse...206763 Neuroligin-2 scFv [L107/90] L107/90 scFv Neuroligin-2 Mouse Mouse 206764 Neuroligin-2 scFv [L107/95...receptor Rat Mouse IgG2a 114484 Anti-Stonin-2 [N346/9R] Stonin-2 Human Mouse IgG2a 114485 Anti-NSD3 [N348...Pan-FHF-A Human Mouse IgG2a 114510 Anti-REEP1/2 [N326D/29R] REEP1/2 Mouse Mouse IgG2a 114511 Anti-Kv3.1b K+ ...Mouse Mouse IgG2a 114547 Anti-Mitofusin-2 [N171/17.4R] Mitofusin-2 Mouse Mouse IgG2a 114548 Anti-Mortalin...Mouse IgG2a 140065 Anti-SCG10/Stathmin-2 [L5/1R] SCG10/Stathmin-2 Rat Mouse IgG2a 140066 Anti-Co-Rest/RCOR1... -
Ras Pathway
TypeCollection...Neurofibromin 1 NFE2L2 Nuclear factor, erythroid 2 like 2 NFKB1 Nuclear factor of kappa light polypeptide...factor receptor bound protein 2 ICMT Isoprenylcysteine carboxyl methyltransferase INSR Insulin receptor INSRR...ARHGEF2 Rho/Rac guanine nucleotide exchange factor 2 CCND CCND1 CCND2 CCND3 Cyclin D CDK CDK4 CDK6 Cyclin-dependent...enhancer of kinase suppressor of Ras CYTH2 Cytohesin 2 DUSP DUSP1 DUSP2 DUSP3 DUSP4 DUSP5 DUSP6 Dual specificity...transcription factor ECT2 Epithelial cell transforming 2 EGFR Epidermal growth factor receptor EIF4EBP EIF4EBP1...binding protein ERBB2 Erb-b2 receptor tyrosine kinase 2 ERK MAPK1 MAPK3 Also known as MAPK; Mitogen-activated...3,4,5-trisphosphate-dependent Rac exchange factor 2 PRKA PRKAA1 PRKAA2 PRKAB1 PRKAB2 PRKAG1 PRKAG2 PRKAG3... -
Fluorescent Protein Guide: Biosensors
TypeCollection...of basal H 2 O 2 levels with peroxiredoxin-based probes Real-time monitoring of basal H 2 O 2 levels with...Belousov Hydrogen Peroxide (H 2 O 2 ) Cytosolic or mitochondrial sensor for H 2 O 2 oxidation (roGFP2-Orp1) ...peroxiredoxin-2-based probe. Nat Commun. 2018 Aug 7;9(1):3145. Hadley Sikes Hydrogen Peroxide (H 2 O 2 ) Monitoring...encoded Ca(2+) indicator with enhanced two-photon absorption. Neurophotonics. 2024 Apr;11(2):024207. doi...Calcium Red fluorescent calcium sensors (fRCaMP1/2, GECO1/2) The kinetic mechanisms of fast-decay red-fluorescent...intracellular Zn(2+) homeostasis. Nat Methods. 2009 Oct;6(10):737-40. Maarten Merkx Zinc eZinCh-2 Zn2+ FRET ... eZinCh-2: A Versatile, Genetically Encoded FRET Sensor for Cytosolic and Intraorganelle Zn(2+) Imaging... -
Genetic Code Expansion
TypeCollection...48696 pANAP AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian TAG Peter...Mammalian TAG Huiwang Ai 73544 pEvol-pAcFRS.2.t1 pAcFRS.2.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73546 pEvol-pAzFRS.2.t1 pAzFRS.2.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial..._AnapRS AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian TAG Simon...Jesse Rinehart 71403 pCMV-DnpK PylRS M. barkeri N6‐(2‐(2,4‐dinitrophenyl)acetyl)lysine (DnpK) Bacterial,...pDule-IBBN (G2) IBBN (G2) synthetase M. jannaschii 4-(2′-bromoisobutyramido)-phenylalanine (IBBN) and structurally...pDule2-IBBN (G2) IBBN (G2) synthetase M. jannaschii 4-(2′-bromoisobutyramido)-phenylalanine (IBBN) and structurally... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TGGTGGCGCAGCAGAGGGagctgatccaggaccaGGCCACCGTGAACATCA DLK1 (site #2) TAL3422 & TAL3423 TGAGGTACAGGCAGCTGGtggcgcagcagagggagcTGATCCAGGACCAGGCCA...TGGAAGACCCGTTGGAGAaagagatcccaccaacTGAAATAAAAGATTCAGA hemogen (site #2) TAL3276 & TAL3277 TGATTTGTTTGTTTGCTaggaggaattcggcggCGACTCAGAGACAGAGA...TGTTTCAGCAGAGCCCCGctgaagagctccccatGGAGATGGAAGGAGTGGA hif1al (site #2) TAL3280 & TAL3281 TGCCCTCAGGACTTCTGCacgcctgaactccgcaAGCTTCTGTCTCCAATA...TGGAGCAGGGTGCGAGTGtgtctgagctgaaggaGGCGGTGGGTCGTTTACA park2 (site #2) TAL3334 & TAL3335 TGATCGTTTTCGTGCGGTttaattccagccatggGTTCCCGGTGGAGTTGGA...TGTTAAGGCTCTGTATAGcagtgtgtgtcctggcCACTTGCTGGGCTCAGGA retinitis pigmentosa 2 (X-linked recessive) TAL3526 & TAL3527 TCTTTTTGTGCTGCGCCAcccagcccataatcgaGTCTTCTACAGGCATGAA...TGGAAACCGAGCTGAAGCccccggcgccccagcccaACACCGGGGGCACGGGGA Sox2 (site #2) TAL3368 & TAL3369 TGGTGGGGTAGACTTTCGagaaaatcggtttaaaTGTATAACATGATGGAAA...TGCTTTCACGCATTGCACtacacattggcaagatgGCAGCCACCATCGGGAGA prothymosin alpha a TAL3344 & TAL3345 TTATCATTCGCATCTCGTatttctctttatattaTTTTATTCCGAGACCCCA... -
Rett Syndrome
TypeCollection...disease-causing mutations in the gene methyl-CpG binding protein 2 ( MECP2 ). MECP2 Rett syndrome is an...mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet . 23, 185–188. (Link opens...PMID: 16905679 Cuddapah et al. 2014. Methyl-CpG-binding protein 2 (MECP2) mutation type is associated ...Neul et al. 2008. Specific mutations in methyl-CpG-binding protein 2 confer different severity in Rett syndrome...phenotypes of males with mutations in Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet...is not clear, however, the ability to bind to methylated DNA and recruit known co-repressors or other ...including: the N - t erminal D omain (NTD) the M ethyl B inding D omain (MBD) a T ranscriptional R epressor... -
Neurodegeneration Research Collection
TypeCollection...New and Noteworthy: Use tau constructs to study aggregation. Saha et al. Nat Commun. 2023 Feb 2. Study ...different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals develop... rodent species. Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 ...with the iPSC toolbox . Lam et al. bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression...guide to using plasmid pooled libraries . New and Noteworthy: Use a CRISPRi system to target alpha-synuclein...system, vesicular brain cells and more. New and Noteworthy: AAV.rTH.PI.Cre.SV40 ready-to-use viral prep ...and fibroblasts into neurons and more. New and Noteworthy: Study aberrant axon initial segment (AIS) plasticity... -
Validated gRNA Sequences
TypeCollection...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš Non-targeting H. .... sapiens GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT... -
mTOR Pathway
TypeCollection...known as RPS6KB1; Ribosomal protein S6 kinase B1 TSC1/2 TSC1 TSC2 Tuberous sclerosis VHL Von Hippel-Lindau...Rictor RPTOR independent companion of MTOR, complex 2 SGK Serum/glucocorticoid regulated kinase 1 Return...disease. Laplante M, Sabatini DM. Cell. 2012 Apr 13;149(2):274-93. doi: 10.1016/j.cell.2012.03.017. PubMed PMID...Complex Symbol Name AKT AKT1 AKT2 AKT3 v-akt murine thymoma viral oncogene homolog FOXO Forkhead box O GBL/... -
CRISPR Plasmids - Epigenetics
TypeCollection...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...including histone acetylation/demethylation, and cytosine methylation/demethylation. CRISPR...p300 histone demethylation by LSD1 cytosine methylation by DNMT3A or MQ1 cytosine demethylation by Tet1 These... -
TALEN Guide
TypeCollection...par with ZF arrays, if not slightly lower. Figure 2: Simplified representation of the Voytas/Bogdanove...variety of backbones in just a few steps ( Figure 2 ). The Bogdanove group also hosts web-based software...mammalian transcription. Nat Biotechnol. 2011 Feb;29(2):149-53. PMID: 21248753 . TALEs for the masses. Rusk...targets cytosine, NI targets adenenine, NG targets thymine, and NN targets guanine (though NN can also bind... -
CRISPR Guide
TypeCollection...left free to interact with the target DNA. Figure 2: Overview of the NHEJ repair mechanism Cas9 will only...systems enable researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single...Cas9 is included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...your experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with...the presence of infectious organisms (like SARS-CoV-2 ) and genetic mutations. Similar to Cas9 and Cas12...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...off-target effects by using a single Cas9 nickase and 2 different gRNAs, which bind in close proximity on ... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...Layer 2-3_IT Isocortex 230803 pAAV-AiE2638m-minBG-iCre(R297T)-BGHpA AiP20142 AiE2638m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 220727 pAAV-AiE2543m-minBG-iCre(R297T)-BGHpA AiP2048 AiE2543m Cre Layer 2-3_IT ...Layer 2-3_IT Isocortex 230402 pAAV-AiE0680m-minBG-iCre(R297T)-BGHpA AiP15072 AiE0680m Cre Layer 2-3_IT ...Opitz-Araya, X., Martinez, R. A., Way, S. W., Thyagarajan, B., . . . Ting, J. T. (2025). Enhancer AAV toolbox... -
CRISPR History and Development for Genome Engineering
TypeCollection...transcribed to make the pre-CRISPR RNA (pre-crRNA). (2) The pre-crRNA is processed into individual crRNAs...2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain effector) Type I (Cas3) Type ... with unprecedented speed and specificity. Figure 2: An overview of CRISPR and NHEJ/HDR. The Cas9/gRNA...regulation of transcription in eukaryotes. Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino...Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell . 163(3):759-71. PMID: 26422227... The first base editors converted cytidine to thymidine; newly engineering base editors convert adenosine... -
A Look Back at One Year of Plasmid Sharing for COVID-19 Research
TypeBlog Post...SARS-CoV-2 spike pseudotyping, visit the SARS-CoV-2 Pseudotyped Virus collection page. SARS-CoV-2 detection...of SARS-CoV-2 entry and become upregulated during viral infection. Expression of SARS-CoV-2 viral proteins...labs in over 75 countries. Figure 1: SARS-CoV-2 proteins and other components. Image from Maya Kostman... protein, variants, and pseudotyping The SARS-CoV-2 virus depends on its spike protein to bind ACE2, the...of infection and how to interfere with it in a BSL-2 lab instead of a BSL-3 lab. Jesse Bloom’s lab published...reagents for pseudotyping lentivirus with the SARS-CoV-2 spike protein. They deposited the plasmids used for...individuals are at neutralizing the different SARS-CoV-2 spike variants. You can learn more about their research... -
Giving gRNAs a Facelift - Synthetic and Beyond
TypeBlog Post...same site, is 2’-fluoro (2’-F), which substitutes a fluorine for the hydroxyl group at the 2’ position. ...most common of these is 2’-O-methylation, where a methyl group is added to the 2’ hydroxyl group of the...together, for example phosphorothioates with 2’-O-methyl modifications, proved more stability than just...generated by introduction of a single photocleavable 2-nitrobenzyl linker in the 20-bp targeting region of...linkages, unlocked nucleic acids, and a constrained ethyl. Can’t decide which RNA backbone modification is...similar advantages, bridged nucleic acids with N-methyl substitutions are slightly more efficient and less...