Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 21 - 40 of 45 results
  1. Zhang Lab CRISPR Page

    Type
    Collection
    ...Truncated MeCP2 promoter-driven SpCas9; for neuronal expression 60958 : PX552; U6 promoter-driven; for sgRNA...are described here. #60224 - AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR...tyroxine binding globulin (TBG, PX602 [#61593] ) promoter, and a U6-driven single guide RNA. The vector can be...PX601; CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven SaCas9; U6-driven sgRNA 61592 : PX600...codon-optimized SpCas9, driven by the truncated MeCP2 promoter (pAAV-pMecp2-SpCas9-spA) for expressing Cas9 in...acceptor: The PX552 plasmid (#60958) contains pAAV-U6::sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor)... directed repair donor template. #60225 - AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR This ...
  2. Boxem Lab CRISPR Plasmids

    Type
    Collection
    ... from the eft-3 promoter, while pMB66 and pMB67 use the hsp-16.48 heat shock promoter. All vectors include....1) promoter. 47945 pMB63 : Expresses C. elegans optimized Cas9 from the eft-3 (eef-1A.1) promoter. 47946...-16.48 promoter. 47947 pMB67 : Expresses C. elegans optimized Cas9 from the hap-16.48 promoter. Please... allows in vitro production of RNA from the T7 promoter, while pMB70 is designed for in vivo transcrition...from T7 promotor. 47943 pMB70 : Can be used to express a CRISPR guide RNA in C. elegans from U6 regulatory...regulatory sequences of an RNA polymerase III transcribed U6 snRNA. In both vectors, the target site sequence ...
  3. Lentivirus Plasmids

    Type
    Collection
    ...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor...silencing were added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor... 3rd U6-driven shRNA empty plasmid; includes a stuffer for easy cloning Root 14748 pLKO.3G 3rd U6-driven...shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression...with a chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned into the plasmid...coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP...Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid with puro resistance. ...
  4. Gersbach Lab CRISPR Plasmids

    Type
    Collection
    ... the H1 promoter. 53187 pmU6-gRNA : Expresses the S. pyogenes sgRNA from the mouse U6 promoter. 53188 ...the human U6 promoter. 53189 ph7SK-gRNA : Expresses the S. pyogenes sgRNA from the 7SK promoter. 53190 pLV...activator VP64. When directed to its target in gene promoters by the sgRNA expressed in trans from pSPgRNA, ...downstream genes. Multiple sgRNAs targeted to the same promoter act synergistically to activate gene expression...
  5. Church Lab CRISPR Plasmids

    Type
    Collection
    ... inducible promoters as well as a gRNA expression construct using the SNR52 snoRNA promoter. A protocol...RNAs (gRNAs) expressed from the human U6 polymerase III promoter. Cas9 unwinds the DNA duplex and cleaves...in S. cerevisiae (budding yeast) from the TEF1 promoter 43804 p415-GalL-Cas9-CYC1t A human codon-optimized...in S. cerevisiae (budding yeast) from the GalL promoter 43803 p426-SNR52p-gRNA.CAN1.Y-SUP4t A gRNA expression...in S. cerevisiae (budding yeast) from the SNR52 promoter Orthogonal CRISPR/Cas9 Systems: Table 3 We have...expression, human optimized 48673 M-NM-sgRNA Mammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTG...expression, human optimized 48672 M-ST1-sgRNA Mammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTG...
  6. FlyCRISPR

    Type
    Collection
    ... allows in vitro production of RNA from the T7 promoter, while pMB70 is designed for in vivo transcrition...nuclease under the control of the Drosophila hsp70 promoter. 45945 pHsp70-Cas9 : The codon-optimized Cas9 ...nuclease under the control of the Drosophila hsp70 promoter used in Gratz, et al. (2013). Plasmid is low copy...under the control of the Drosophila snRNA:U6:96Ab promoter. 51019 pDsRed-attP : Vector for generating dsDNA...regulatory sequences of an RNA polymerase III transcribed U6 snRNA. In both vectors, the target site sequence ... 3xP3-DsRed. (Also known as pHD-DsRed-att). 51026 U6-BbsI-crRNA : Generates crRNA for use in combination...
  7. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...lower efficiency than NHEJ. Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants...homology-directed repair (HDR). Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused...desired edits on an RT template. Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...activator to your specific locus. Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select...variety of Cas-containing plasmids. gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed...Virmilion none, need Cas9 plasmid Bullock and Port pCFD4-U6:1_U6:3tandemgRNAs dU6:1 and dU6:3 BbsI Injection ...
  8. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...features and pX458 modifications: replacement of Cbh promoter with EF1alpha addition of mCherry reporter variant...reporters via an H2B fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide expressing plasmids...shuttle plasmids to insert a second guide within a U6-guide cassette. This process is compatible with all...
  9. CRISPR-Cas/RGN expression plasmids for human cells

    Type
    Collection
    ...vectors express a customized guide RNA from a U6 promoter. Individual plasmids can be ordered via the links...listed below ( MLM3639 and JDS246 ) harbor a CMV promoter that drives expression of a transcript encoding...
  10. Dimeric CRISPR RNA-guided FokI Nuclease (RFN)

    Type
    Collection
    ...single transcript whose expression is driven by a U6 promoter. The two gRNAs expressed are flanked by Csy4 .... Expression of this fusion is driven by a CAG promoter. Note that the FokI-dCas9 fusion encoded by this...
  11. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...either the Thy1 or CAG promoter, while Brainbow AAV is under control of the EF1a promoter. Livet et al., ...known as SpyLigase and is a protein domain that promotes the formation of an isopeptide bond between 2 ...insert fragments of DNA containing basic parts (promoters, UTRs, coding sequences, terminators, etc) into... creating a single transcriptional unit (Ex: a promoter, 5’UTR, coding region, and terminator). Next, ...individual types of pre-cloned insert modules (plant promoter, N-terminal tag, coding sequence of the gene of...ES) cells. These vectors, termed RUSH (For ROSA26 U6 short hairpin) and CRUSH (Conditional RUSH) use Cre-mediated...
  12. CRISPR Plasmids - C. elegans

    Type
    Collection
    ...lower efficiency than NHEJ. Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...activator to your specific locus. Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select...variety of Cas-containing plasmids. gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed...NGG) pDD162 (Peft-3::Cas9 + Empty sgRNA) R07E5.16 U6 yes, cut Goldstein DR274 T7 BsaI In vitro transcription...
  13. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...the gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...fluorophores, generate expression vectors with various promoters suitable for in vivo expression, and/or produce...continuous expansion of compatible backbones, promoters, and genes available to the community. If you ...
  14. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...under from the CB promoter pCDH-CB-iCre 72257 Express iCre under from the CB promoter pCDH-CB-FLPe-P2A-...the CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV promoter pCDH-EF1 72266 ...interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from the CB promoter pCDH-PGK 72268 xpress...phosphoglycerate kinase I) promoter pCDH-CMV4 72284 Express gene of interest from the CMV promoter. WPRE has been ...from the CB promoter pCDH-EF1s 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2... EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7...
  15. Cre-lox system

    Type
    Collection
    ...system is tight temporal regulation. Promoter-regulated Cre: The promoter region defines the areas in which...active promoter like CAG, or expressed only in a subset of cells under a more specific promoter (e.g. ... PBAD promoter Bacterial Richmond 112614 pVHC Venus and Cre-ERT2 with MCS for inserting promoter none ...inserting promoter none Mammalian Heller 112616 pmTHC TFP and Cre-ERT2 with MCS for inserting promoter none...respectively) and placed under the control of different promoters. Expression of both N and CCre in the same cell...your experiment. You can search the table for the promoter, fusion, or expression system of choice. We also...preps of Cre are available. ID Plasmid Description Promoter Expression System PI 8394 p209 pCMV-cre-K Cre-...
  16. Mammalian RNAi Tools

    Type
    Collection
    ...pLVCT-tTR-KRAB 2nd generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...2SM2 2nd generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off Patrick...generation; Transgene (hEF-1alpha promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick... 2nd generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick... 2nd generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off Patrick...generation; Transgene (hUbiquitin promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...2nd generation; Transgene (hPrion promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...
  17. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ...sequence into a backbone that uses the human U6 promoter to drive expression, is it necessary to add a...to the start of my target sequence? The human U6 promoter prefers a 'G' at the transcription start site...of the crRNA) is also expressed from a separate promoter. In the pre-processing form, the crRNA contains...
  18. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Yildiz 159787 pGL3-U6-pegRNA_KCNA1-EGFP KCNA1 U6 Episodic ataxia Xiaolong Wang 159788 pGL3-U6-sgRNA_KCNA1-mcherry...190900 pAAV2ss-U6-sgHTT1-7sk-sgCas9 HTT U6, 7sk Huntington's Nicole Deglon 190901 pAAVss-U6-sgHTT51-7sk-...7sk-Cas9 HTT U6, 7sk Huntington's Nicole Deglon 190902 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1 HTT GFP U6, EFS Huntington's...Deglon 190903 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9 HTT GFP U6, EFS Huntington's Nicole Deglon 191487... Other Promoter CMV T7 polH GAL Other Clear Filters Addgene ID Plasmid Name Gene Tags Promoter Disease...78622 pX335_HR_Prnp_3 PRNP U6 Dementia Walker Jackson 78623 pX459_HR_Prnp_3 PRNP U6 Dementia Walker Jackson...MS2)_Prnp_SAM1 PRNP U6 Dementia Walker Jackson 78625 sgRNA(MS2)_Prnp_SAM2 PRNP U6 Dementia Walker Jackson...
  19. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...the 20-mer is not G. sgRNA expression from the U6 promoter of the pX330 vector is enhanced by the inclusion...each sample and sequence each colony using a U6 promoter forward primer: CGTAACTTGAAAGTATTTCGATTTCTTGGC...
  20. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer...baculovirus vector with polyhedrin promoter, reverse primer pQE promoter CCCGAAAAGTGCCACCTG (Qiagen) 5' of...
Showing: 21 - 40 of 45 results