Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Church Lab CRISPR Plasmids Available from Addgene


Bacteria and archaea have evolved adaptive immune defenses termed clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems that use short RNA to direct degradation of foreign nucleic acids. We have engineered the type II bacterial CRISPR system to function with custom guide RNA (gRNA) in human cells: this involves co- expression of a Cas9 protein bearing a C terminus SV40 nuclear localization signal with one or more guide RNAs (gRNAs) expressed from the human U6 polymerase III promoter. Cas9 unwinds the DNA duplex and cleaves both strands upon recognition of a target sequence by the gRNA, but only if the correct protospacer-adjacent motif (PAM) is present at the 3′ end (see Figure).

Church-CRISPR-plasmid-design-cartoon

Mammalian System: Table 1

We provide a collection of reagents for custom CRISPR mediated gene-targeting.

A protocol for synthesizing gRNAs: Icon hCRISPR gRNA synthesis protocol (115.2 KB)

A genome-wide resource of ~190k unique gRNAs targeting ~40.5% of human exons can be accessed here.

This set of plasmids is described in:

RNA-Guided Human Genome Engineering via Cas9. Mali P, Yang L, Esvelt KM, Aach J, Guell M, Dicarlo JE, Norville JE, Church GM. Science. 2013 Jan 3. PubMed PMID 23287722

Individual plasmids can be ordered via the links below:

   ID Plasmid Description
41824 gRNA Empty Vector The backbone that a target sequence gets cloned into to create the gRNA
41815 hCas9 A human codon-optimized Cas9 expression plasmid
41816 hCas9 D10A A human codon-optimized Cas9 expression plasmid mutated to nick, rather than cut DNA
41817 gRNA_AAVS1-T1 A gRNA to human AAVS1
41818 gRNA_AAVS1-T2 A gRNA to human AAVS1
41819 gRNA_GFP-T1 A gRNA to GFP
41820 gRNA_GFP-T2 A gRNA to GFP
41821 gRNA_DNMT3a-T1 A gRNA to DNMT3a
41822 gRNA_DNMT3a-T2 A gRNA to DNMT3a
41823 gRNA_DNMT3b A gRNA to DNMT3b

Yeast System: Table 2

To function in yeast cells, we designed Cas9 protein expression constructs using constitutive and inducible promoters as well as a gRNA expression construct using the SNR52 snoRNA promoter.

A protocol for synthesizing gRNAs: Icon hCRISPR gRNA synthesis protocol (115.2 KB)

This set of plasmids is described in:

Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Dicarlo JE, Norville JE, Mali P, Rios X, Aach J, Church GM. Nucleic Acids Res. 2013 Mar 4. PubMed PMID 23460208

Individual plasmids can be ordered via the links below:

   ID Plasmid Description
43802 p414-TEF1p-Cas9-CYC1t A human codon-optimized Cas9 for expression in S. cerevisiae (budding yeast) from the TEF1 promoter
43804 p415-GalL-Cas9-CYC1t A human codon-optimized Cas9 for expression in S. cerevisiae (budding yeast) from the GalL promoter
43803 p426-SNR52p-gRNA.CAN1.Y-SUP4t A gRNA expression plasmid for use in S. cerevisiae (budding yeast) from the SNR52 promoter

Orthogonal CRISPR/Cas9 Systems: Table 3

We have characterized a set of orthogonal Cas9 proteins to allow multiple Cas9-mediated activities to be performed simultaneously within individual cells. Because these proteins recognize different guide RNAs, they can be independently targeted to distinct sets of sequences. Our currently available set of Cas9 proteins includes three orthogonal variants optimized for use in human cells and four orthogonal variants usable in bacteria.

Cas9 proteins in human cells:

Streptococcus pyogenes (SP): This is the classical Cas9 protein used in most studies to date.

Neisseria meningitidis (NM): Significantly smaller than the above Cas9 protein, NM is comparably active as a nuclease and a transcriptional activator.

Streptococcus thermophilus #1 (ST1): Almost as small as NM, ST1 consistently yields slightly higher activities than the others as a nuclease and as an activator, but is more restricted in the sequences it can target.

Cas9 proteins in bacteria:

SP, NM, ST1: all of these efficiently mediate cutting and repression in bacteria, with NM exhibiting slightly superior repression.

Treponema denticola (TD): Larger than SP, it mediates efficient cutting and nicking in bacteria but performs poorly as a transcriptional repressor.

All genes except the SP nuclease are human codon optimized but function well in E. coli . Bacteria expressing NM and TD may grow slightly more slowly than those expressing SP and ST1.

Protospacer-adjacent motifs (PAMs):

Please note that NM, ST1, and TD recognize different PAMs than does the classical SP Cas9. We experimentally determined these PAMs using a highly stringent selection, which revealed that PAM recognition is more complex than previously thought. In particular, combinations of highly unfavorable bases at positions adjacent to those formally required can significantly reduce activity, while particular protospacers interact nonlinearly with different PAM sequences to determine overall activity at the site. For example, when paired with either of the protospacers utilized in our selection, we observed that NM will recognize sequences with PAMs matching:

NNNNGA, NNNNGTT, NNNNGNNT,

just as well as the PAM determined by bioinformatics, NNNNGATT. However, it is possible that NNNNGATT will prove superior for less favorable protospacers and applications requiring particularly tight binding. In these cases it may be advisable to use the consensus sequence. See the publication for details.

A protocol for synthesizing gRNAs: Icon Cas9 orthologs gRNA cloning protocol (104.1 KB)

This set of plasmids is described in:

Orthogonal Cas9 proteins for RNA-guided genome regulation and editing. Esvelt KM, Mali P, Braff JL, Moosburner M, Yaung SJ, Church GM. Nat Methods. 2013 Sep 29. PubMed PMID 24076762

Individual plasmids can be ordered via the links below:

   ID Plasmid Description
48669 M-ST1cas Mammalian S. thermophilus #1 Cas9 expression, human optimized
48670 M-NMcas Mammalian N. meningitidis Cas9 expression, human optimized
48673 M-NM-sgRNA Mammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTG
48675 M-ST1n-VP64 Mammalian ST1-VP64 nuclease-null Cas9 activator expression, human optimized
48676 M-NMn-VP64 Mammalian NM-VP64 nuclease-null Cas9 activator expression, human optimized
48672 M-ST1-sgRNA Mammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTG
48674 M-SPn-VP64 Mammalian SP-VP64 nuclease-null Cas9 activator expression, human optimized
48646 DS-NMcas Bacterial N. meningitidis Cas9 (NM) + tracrRNA expression, cloDF13/spectinomycin
48668 M-SPcas Mammalian S. pyogenes Cas9 expression, human optimized
   48645 DS-SPcas Bacterial S. pyogenes Cas9 (SP) + tracrRNA expression, cloDF13/spectinomycin
   48647 DS-ST1cas Bacterial S. thermophilus #1 Cas9 (ST1) + tracrRNA expression, cloDF13/spectinomycin
   48648 DS-TDcas Bacterial T. denticola Cas9 (TD) + tracrRNA expression, cloDF13/spectinomycin
   48649 PM-SP!TA Bacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol
   48650 PM-SP!TB Bacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol
   48651 PM-NM!TA Bacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol
   48652 PM-NM!TB Bacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol
   48653 PM-ST1!TA Bacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol
   48654 PM-ST1!TB Bacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol
   48655 PM-TD!TA Bacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol
   48656 PM-TD!TB Bacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol
   48657 DS-SPcasN- Bacterial nuclease-null SP Cas9 expression
   48659 DS-ST1casN- Bacterial nuclease-null ST1 Cas9 expression
   48660 DS-TDcasN- Bacterial nuclease-null TD Cas9 expression
   48661 SK-YFP-SPNM-B Bacterial SP and NM repression YFP reporter: protospacer B
   48662 SK-YFP-ST1-B Bacterial ST1 repression YFP reporter: protospacer B
   48663 SK-YFP-TD-B Bacterial TD repression YFP reporter: protospacer B
   48664 SK-YFP-NM-A Bacterial NM repression YFP reporter: protospacer A
   48665 SK-YFP-ST1-A Bacterial ST1 repression YFP reporter: protospacer A
   48666 SK-YFP-TD-A Bacterial TD repression YFP reporter: protospacer A
   48667 EE-SP!gIII Bacterial SP Cas9 targeting filamentous phage gene III at five protospacers
   48671 M-SP-sgRNA Mammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTG
   48677 M-tdTom-SP Mammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacer
   48678 M-tdTom-ST1 Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacer
   48679 M-tdTom-NM Mammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacer