Church Lab CRISPR Plasmids Available from Addgene
Bacteria and archaea have evolved adaptive immune defenses termed clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems that use short RNA to direct degradation of foreign nucleic acids. We have engineered the type II bacterial CRISPR system to function with custom guide RNA (gRNA) in human cells: this involves co- expression of a Cas9 protein bearing a C terminus SV40 nuclear localization signal with one or more guide RNAs (gRNAs) expressed from the human U6 polymerase III promoter. Cas9 unwinds the DNA duplex and cleaves both strands upon recognition of a target sequence by the gRNA, but only if the correct protospacer-adjacent motif (PAM) is present at the 3′ end (see Figure).

Mammalian System: Table 1
We provide a collection of reagents for custom CRISPR mediated gene-targeting.
A protocol for synthesizing gRNAs: hCRISPR gRNA synthesis protocol 115.2 KB
A genome-wide resource of ~190k unique gRNAs targeting ~40.5% of human exons can be accessed here.
This set of plasmids is described in:
RNA-Guided Human Genome Engineering via Cas9. Mali P, Yang L, Esvelt KM, Aach J, Guell M, Dicarlo JE, Norville JE, Church GM. Science. 2013 Jan 3. PubMed PMID 23287722
Individual plasmids can be ordered via the links below:
ID | Plasmid | Description | |
---|---|---|---|
41824 | gRNA Empty Vector | The backbone that a target sequence gets cloned into to create the gRNA | |
41815 | hCas9 | A human codon-optimized Cas9 expression plasmid | |
41816 | hCas9 D10A | A human codon-optimized Cas9 expression plasmid mutated to nick, rather than cut DNA | |
41817 | gRNA_AAVS1-T1 | A gRNA to human AAVS1 | |
41818 | gRNA_AAVS1-T2 | A gRNA to human AAVS1 | |
41819 | gRNA_GFP-T1 | A gRNA to GFP | |
41820 | gRNA_GFP-T2 | A gRNA to GFP | |
41821 | gRNA_DNMT3a-T1 | A gRNA to DNMT3a | |
41822 | gRNA_DNMT3a-T2 | A gRNA to DNMT3a | |
41823 | gRNA_DNMT3b | A gRNA to DNMT3b |
Yeast System: Table 2
To function in yeast cells, we designed Cas9 protein expression constructs using constitutive and inducible promoters as well as a gRNA expression construct using the SNR52 snoRNA promoter.
A protocol for synthesizing gRNAs: hCRISPR gRNA synthesis protocol 115.2 KB
This set of plasmids is described in:
Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Dicarlo JE, Norville JE, Mali P, Rios X, Aach J, Church GM. Nucleic Acids Res. 2013 Mar 4. PubMed PMID 23460208
Individual plasmids can be ordered via the links below:
ID | Plasmid | Description | |
---|---|---|---|
43802 | p414-TEF1p-Cas9-CYC1t | A human codon-optimized Cas9 for expression in S. cerevisiae (budding yeast) from the TEF1 promoter | |
43804 | p415-GalL-Cas9-CYC1t | A human codon-optimized Cas9 for expression in S. cerevisiae (budding yeast) from the GalL promoter | |
43803 | p426-SNR52p-gRNA.CAN1.Y-SUP4t | A gRNA expression plasmid for use in S. cerevisiae (budding yeast) from the SNR52 promoter |
Orthogonal CRISPR/Cas9 Systems: Table 3
We have characterized a set of orthogonal Cas9 proteins to allow multiple Cas9-mediated activities to be performed simultaneously within individual cells. Because these proteins recognize different guide RNAs, they can be independently targeted to distinct sets of sequences. Our currently available set of Cas9 proteins includes three orthogonal variants optimized for use in human cells and four orthogonal variants usable in bacteria.
Cas9 proteins in human cells:
Streptococcus pyogenes (SP): This is the classical Cas9 protein used in most studies to date.
Neisseria meningitidis (NM): Significantly smaller than the above Cas9 protein, NM is comparably active as a nuclease and a transcriptional activator.
Streptococcus thermophilus #1 (ST1): Almost as small as NM, ST1 consistently yields slightly higher activities than the others as a nuclease and as an activator, but is more restricted in the sequences it can target.
Cas9 proteins in bacteria:
SP, NM, ST1: all of these efficiently mediate cutting and repression in bacteria, with NM exhibiting slightly superior repression.
Treponema denticola (TD): Larger than SP, it mediates efficient cutting and nicking in bacteria but performs poorly as a transcriptional repressor.
All genes except the SP nuclease are human codon optimized but function well in E. coli . Bacteria expressing NM and TD may grow slightly more slowly than those expressing SP and ST1.
Protospacer-adjacent motifs (PAMs):
Please note that NM, ST1, and TD recognize different PAMs than does the classical SP Cas9. We experimentally determined these PAMs using a highly stringent selection, which revealed that PAM recognition is more complex than previously thought. In particular, combinations of highly unfavorable bases at positions adjacent to those formally required can significantly reduce activity, while particular protospacers interact nonlinearly with different PAM sequences to determine overall activity at the site. For example, when paired with either of the protospacers utilized in our selection, we observed that NM will recognize sequences with PAMs matching:
NNNNGA, NNNNGTT, NNNNGNNT,
just as well as the PAM determined by bioinformatics, NNNNGATT. However, it is possible that NNNNGATT will prove superior for less favorable protospacers and applications requiring particularly tight binding. In these cases it may be advisable to use the consensus sequence. See the publication for details.
A protocol for synthesizing gRNAs: Cas9 orthologs gRNA cloning protocol 104.1 KB
This set of plasmids is described in:
Orthogonal Cas9 proteins for RNA-guided genome regulation and editing. Esvelt KM, Mali P, Braff JL, Moosburner M, Yaung SJ, Church GM. Nat Methods. 2013 Sep 29. PubMed PMID 24076762
Individual plasmids can be ordered via the links below:
ID | Plasmid | Description | |
---|---|---|---|
48669 | M-ST1cas | Mammalian S. thermophilus #1 Cas9 expression, human optimized | |
48670 | M-NMcas | Mammalian N. meningitidis Cas9 expression, human optimized | |
48673 | M-NM-sgRNA | Mammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTG | |
48675 | M-ST1n-VP64 | Mammalian ST1-VP64 nuclease-null Cas9 activator expression, human optimized | |
48676 | M-NMn-VP64 | Mammalian NM-VP64 nuclease-null Cas9 activator expression, human optimized | |
48672 | M-ST1-sgRNA | Mammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTG | |
48674 | M-SPn-VP64 | Mammalian SP-VP64 nuclease-null Cas9 activator expression, human optimized | |
48646 | DS-NMcas | Bacterial N. meningitidis Cas9 (NM) + tracrRNA expression, cloDF13/spectinomycin | |
48668 | M-SPcas | Mammalian S. pyogenes Cas9 expression, human optimized | |
48645 | DS-SPcas | Bacterial S. pyogenes Cas9 (SP) + tracrRNA expression, cloDF13/spectinomycin | |
48647 | DS-ST1cas | Bacterial S. thermophilus #1 Cas9 (ST1) + tracrRNA expression, cloDF13/spectinomycin | |
48648 | DS-TDcas | Bacterial T. denticola Cas9 (TD) + tracrRNA expression, cloDF13/spectinomycin | |
48649 | PM-SP!TA | Bacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol | |
48650 | PM-SP!TB | Bacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol | |
48651 | PM-NM!TA | Bacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol | |
48652 | PM-NM!TB | Bacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol | |
48653 | PM-ST1!TA | Bacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol | |
48654 | PM-ST1!TB | Bacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol | |
48655 | PM-TD!TA | Bacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol | |
48656 | PM-TD!TB | Bacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol | |
48657 | DS-SPcasN- | Bacterial nuclease-null SP Cas9 expression | |
48659 | DS-ST1casN- | Bacterial nuclease-null ST1 Cas9 expression | |
48660 | DS-TDcasN- | Bacterial nuclease-null TD Cas9 expression | |
48661 | SK-YFP-SPNM-B | Bacterial SP and NM repression YFP reporter: protospacer B | |
48662 | SK-YFP-ST1-B | Bacterial ST1 repression YFP reporter: protospacer B | |
48663 | SK-YFP-TD-B | Bacterial TD repression YFP reporter: protospacer B | |
48664 | SK-YFP-NM-A | Bacterial NM repression YFP reporter: protospacer A | |
48665 | SK-YFP-ST1-A | Bacterial ST1 repression YFP reporter: protospacer A | |
48666 | SK-YFP-TD-A | Bacterial TD repression YFP reporter: protospacer A | |
48667 | EE-SP!gIII | Bacterial SP Cas9 targeting filamentous phage gene III at five protospacers | |
48671 | M-SP-sgRNA | Mammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTG | |
48677 | M-tdTom-SP | Mammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacer | |
48678 | M-tdTom-ST1 | Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacer | |
48679 | M-tdTom-NM | Mammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacer |