Skip to main content
Addgene
Showing: 1 - 5 of 5 results

  1. p53 Pathway

    Type
    Collection
    ...death agonist CASP3 Caspase 3, apoptosis-related cysteine peptidase CASP8 Caspase 8, apoptosis-related ...apoptosis-related cysteine peptidase CASP9 Caspase 9, apoptosis-related cysteine peptidase Cyclin B CCNB1 CCNB2 CCNB3 ...

  2. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ... publication title or keywords (e.g. "RCaMP", "caspase", "Dynamic Visualization of mTORC1 Activity in ...Genetically Encoded Ca2+ Indicators. Science. 2011 Sep 8. Robert Campbell Calcium D and D2 family Cameleon ...GFP-linked biosensors. Proc Natl Acad Sci U S A. 2008 Jan 8. Wolfgang Dostmann cGMP (cyclic GMP) Green fluorescent...Biosensors for Citrate. ACS Cent Sci. 2020 Aug 26;6(8):1441-1450. Robert Campbell Glucose FRET sensor to... and in vivo studies. Nat Biotechnol. 2018 Sep;36(8):726-737. Yulong Li Acetylcholine Optimized acetylcholine...in vivo imaging of GABA. Nat Methods. 2019 Aug;16(8):763-770. Loren Looger GABA A fluorescent sensor for...discovery using an engineered biosensor. Cell. 2021 Apr 8. pii: S0092-8674(21)00374-3. Lin Tian Serotonin Cilia-targeted...

  3. Antibodies 101: Epitope Tags

    Type
    Blog Post
    ...tagged protein. These peptides consist of as little as 8 or as many as several hundred amino acids, depending...pros and cons. FLAG FLAG is a synthetically derived 8 amino acid tag (DYKDDDDK) that can be added multiple... is not suitable for use in apoptotic cells as Caspase3/7 both cleave after the DVPD sequence. Check out...

  4. Immunology Research Plasmids and Resources

    Type
    Collection
    ...chemokine (C-C motif) ligand 23 CK-BETA-8, CKb8, Ckb-8, Ckb-8-1, MIP-3, MIP3, MPIF-1, SCYA23 CCL24 chemokine...heavy diversity 2-21 IGHD221 IGHD2-8 immunoglobulin heavy diversity 2-8 DLR1, IGHD28 IGHD3-10 immunoglobulin...69 IGHV1-E, IGHV169, IGHV1E IGHV1-8 immunoglobulin heavy variable 1-8 IGHV18 IGHV1-C immunoglobulin heavy...kappa variable 1-6 IGKV16, L11 IGKV1-8 immunoglobulin kappa variable 1-8 IGKV18, L9 IGKV1-9 immunoglobulin...1D-43 IGKV1D43, L23, L23a IGKV1D-8 immunoglobulin kappa variable 1D-8 IGKV1D8, L24, L24a IGKV2-24 immunoglobulin...-functional) IGLV233, V1-9 IGLV2-8 immunoglobulin lambda variable 2-8 IGLV28, V1-2 IGLV3-1 immunoglobulin...

  5. Validated gRNA Sequences

    Type
    Collection
    ...GCTCTGCTGGGAAGCGAATC 75163 cut S. pyogenes 27194728 Bornhauser Caspase-8 H. sapiens GCCTGGACTACATTCCGCAA 75164 cut S. pyogenes...
Showing: 1 - 5 of 5 results