... cells. Moreover, they optimized the specific attachment sites via sequence engineering, enabling even...Eleonora I. Ioannidi, Matthew T. N. Yarnall, Cian Schmitt-Ulms, Rohan N. Krajeski, Justin Lim, Lukas Villiger...

...called BLESS (direct in situ breaks labeling, enrichment on streptavidin and next-generation sequencing.../biot.201400046  Strecker J, Jones S, Koopal B, Schmid-Burgk J, Zetsche B, Gao L, Makarova KS, Koonin ...

...site so that transcripts undergo nonstop decay (Frischmeyer et al., 2002). How to pick a split AAV method...1–12 . https://doi.org/10.1089/hgtb.2015.140 Frischmeyer PA (2002) An mRNA Surveillance Mechanism That...

...Plasmids 101: Aptamer Fluorophores describes the enrichment process used to evaluate oligonucleotides for...systematic evolution of ligands by exponential enrichment (SELEX). After 4-6 rounds of SELEX, the RNA pool...

...Plasmid #67178) for use in the system outlined in Schmid-Burgk, J.L., et al (2). In this post, I’ll cover... 22894855. PubMed Central PMCID: PMC3501149. 2. Schmid, J.L., et al. (2016) CRISPaint allows modular base-specific...

...Charoensawan V, Adryan B, Thisse B, Thisse C, Teichmann S and Wright GJ Molecular & cellular proteomics...GJ. Genome research 2008 Apr; 18(4):622-30. A benchmarked protein microarray-based platform for the identification...

...higher specificity, increased versatility in probe attachment, and compatibility with far-red and near-infrared...References Allikalt, A., Purkayastha, N., Flad, K., Schmidt, M. F., Tabor, A., Gmeiner, P., Hübner, H., & Weikert...

... or fluorescent molecules such as Fluoro-Gold (Schmued and Fallon, 1986) are used. To facilitate cellular...PMID: 22418061. PubMed Central PMCID: PMC3381869. Schmued L.C., and Fallon J.H. (1986). Fluoro-Gold: a new...

...leukocyte cell-derived chemotaxin 2 MGC126628, chm-II, chm2 LTB4R leukotriene B4 receptor BLT1, BLTR, CMKRL1...leukocyte cell-derived chemotaxin 2 MGC126628, chm-II, chm2 LEFTY1 left-right determination factor 1 LEFTB...PIG4, SAA, TP53I4 SAA2 serum amyloid A2 - SBDS Shwachman-Bodian-Diamond syndrome CGI-97, FLJ10917, SDS,...

...25490046 Schmitt-Ulms Prnp M. musculus TTGGCCCCATCCACCGCCAT 61856 cut S. pyogenes 25490046 Schmitt-Ulms Pten...

...CRISPR Knockout Library 104861 Knockout Mouse Teichmann N/A (retroviral) 5 90,230 RNA-Binding Protein ...

... systems Proof of Concept These systems were benchmarked on positive control genes in CD4+ and CD8+ T ...

...How to Design Your gRNA Use the CRISPR Software Matchmaker Browse Alll of Our CRISPR Posts Additional Resources...

...from webpage clippings, photographs, and file attachments. Organize your notes into notebooks, create checklists...

...first mapping of intrachromosomal loci, a major benchmark in characterizing the 4D nucleome. Future modifications...

...usage: Vagaries of conditional gene targeting. Schmidt-Supprian M, Rajewsky K. Nat Immunol. 2007 Jul;8...

... gene targets. These pooled libraries include enrichment against kinases, cell cycle proteins, and more...

... Addgene blog: Learn how the CRISPR software matchmaker can help you choose the best CRISPR software ...

... that one project led by postdoc Dr. Stephanie Schmidt not only produced partially assembled genomes, ...

...Fluorescence Activated Cell Sorting (FACS), allowing for enrichment of successfully targeted cells that can be used...