Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 21 - 26 of 26 results
  1. Validated gRNA Sequences

    Type
    Collection
    ...see article 60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes...AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes 26829286 Lu LacZ E.coli CCCGAATCTCTATCGTGCGG 74179 cut S. pyogenes...
  2. Molecular Biology Reference

    Type
    Guide
    ...lacIq ∆(lacZ)M15 zzf::Tn10 (TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15 e14- Φ80dlacZ∆M15 recA1...lambda- leu mtl1 DH5alpha Invitrogen F- Phi80lacZDeltaM15 Delta(lacZYA-argF) U169 recA1 endA1 hsdR17(rk-, ...Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZDeltaM15 Delta-lacX74 recA1 araDelta139 D(ara-leu)7697...Top10 Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZM15 Delta-lacX74 recA1 araD139 Delta(ara-leu)7697...
  3. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...pCAG-FLEX-EGFP-WPRE Hongkui Zeng AV-1-PV0102 105531-AAV1 pAAV.CMV.LacZ.bGH James M. Wilson AV-1-PV0105 105532-AAV1 pAAV.CMV.ffLuciferase.SV40...pAAV.CMV.PI.EGFP.WPRE.bGH James M. Wilson AV-5-PV0102 105531-AAV5 pAAV.CMV.LacZ.bGH James M. Wilson AV-5-PV1917 105541-AAV5 pENN.AAV.CamKII0.4...pAAV.CMV.PI.EGFP.WPRE.bGH James M. Wilson AV-8-PV0102 105531-AAV8 pAAV.CMV.LacZ.bGH James M. Wilson AV-8-PV0105 105532-AAV8 pAAV.CMV.ffLuciferase.SV40...pAAV.CMV.PI.EGFP.WPRE.bGH James M. Wilson AV-9-PV0102 105531-AAV9 pAAV.CMV.LacZ.bGH James M. Wilson AV-9-PV1845 105556-AAV9 pENN.AAV.tMCK.PI.eGFP.WPRE.bGH...EYFP Karl Deisseroth AV-2-PV0102 105531-AAV2 pAAV.CMV.LacZ.bGH James M. Wilson AV-2-PV1917 105541-AAV2 pENN.AAV.CamKII0.4...pAAV.CAG.LSL.tdTomato Hongkui Zeng AV-8-PV0142 105534-AAV8 pAAV.TBG.PI.LacZ .bGH James M. Wilson AV-1-PV1696 105539-AAV1...
Showing: 21 - 26 of 26 results