Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 9 of 9 results

  1. Scientists Map the SARS-CoV-2-Human Interaction Network

    Type
    Blog Post
    ...all SARS-CoV-2 viral proteins except for Nsp3 and Nsp16, and includes an additional catalytically dead version...spec for two of the remaining viral proteins. Only Nsp11 ran bigger than expected, and Orf7b gave a lot of...

  2. EXPRESs Plasmids for Plasmodium falciparum

    Type
    Collection
    ...ama1CD4d3+4-blac 47709 MSP1-bio 47710 MSP2-bio 47717 MSP4-bio 47718 MSP5-bio 47719 MSP10-bio 47725 P12-bio ...47731 MSP3-bio 47732 MSP6-bio 47733 H101-bio 47734 MSP11-bio 47735 MSP7-bio 47736 MSRP1-bio 47737 MSRP2-bio...

  3. EXPRESs plasmids for Plasmodium vivax

    Type
    Collection
    ...parasite, P. vivax . Plasmid ID Plasmid Name 68505 MSP1-bio 68506 MSP3.1-bio 68507 MSP3.3-bio 68508 MSP3.4...MSP7.1-bio 68513 MSP7.6-bio 68514 MSP7.9-bio 68515 MSP10-bio 68516 P12-bio 68517 P12p-bio 68518 P38-bio 68519...

  5. p53 Pathway

    Type
    Collection
    ...ubiquitin protein ligase 1 TSC2 Tuberous sclerosis 2 TSP1 Thrombospondin 1 Return to top References Unravelling...

  6. Ras Pathway

    Type
    Collection
    ...kinase suppressor of Ras CYTH2 Cytohesin 2 DUSP DUSP1 DUSP2 DUSP3 DUSP4 DUSP5 DUSP6 Dual specificity phosphatase...

  7. Validated gRNA Sequences

    Type
    Collection
    ...GAGTAAAAAATTGTACTTGG 64330 cut S. pyogenes 25281382 Jin USP13 H. sapiens GCCGCCCGGCATGCCGAACA 61812 cut S. pyogenes...

  8. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pMCS-rybozyme-IRES-CAS9 64668 Mammalian yes, cut S. pyogenes W Fujii MSP1673 65769 Bacteria T7 yes, cut N. meningitidis Joung...

  9. Immunology Research Plasmids and Resources

    Type
    Collection
    ...THBS1 thrombospondin 1 THBS, THBS-1, TSP, TSP-1, TSP1 TRPC4AP transient receptor potential cation channel...MGC45246 AR androgen receptor AIS, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM AREG amphiregulin AR...
Showing: 1 - 9 of 9 results