...GTCCCCTCCACCCCACAGTG 48677 M-tdTom-SP Mammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG...GTCCCCTCCACCCCACAGTG protospacer 48678 M-tdTom-ST1 Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG...GTCCCCTCCACCCCACAGTG protospacer 48679 M-tdTom-NM Mammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG...

...different thermal quenching rates (mNeonGreen and tdTomato), they produce a temperature sensor that significantly...

... pFA6a-link-tdTomato-SpHis5 - Yeast Expression tdTomato-N1 - Mammalian Expression tdTomato-C1 - Mammalian... Bacterial Expression tdTomato 554 581 95 4.7 1 hr Tandem-dimer pCSCMV:tdTomato - Mammalian Expression...Mammalian Expression tdTomato-pBAD - Bacterial Expression Jump to Top Red Protein Excitation (nm) Emission...

...Dorus Gadella 37351 pQC membrane TdTomato IX Membrane Palmitoylation TdTomato Connie Cepko 22479 FUmGW Membrane...118737 pBOB-CARMIL2 BH domain-tdTomato Plasma Membrane CARMIL2 BH domain tdTomato John Cooper *Fusions to other...

...Yellow-orange fluorescent proteins like TagRFP, tdTomato, DsRed, the mKate series, or tdKatushka2 (Drobizhev...

...NLucTom Knock-in of NLuc-tdTomato at endogenous MECP2 locus Castaneus MECP2-NLuc-tdTomato mouse reporter cell...

.... Using the FAST system, Ye’s lab could edit a tdTomato fluorescent reporter gene in mice using Minicircle...

... vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2 can be...

... 58112 tdTomato-MAPTau-C-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58113 tdTomato-MAPTau-...TARDBP GFP CMV ALS Zuoshang Xu 28205 wtTDP43tdTOMATOHA TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 ...tdTomato-MAPTau-N-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58259 pBabe-Neuroserpin SERPINI1 Dementia Joan...

...Trypanosoma cruzi yes, cut S. pyogenes Neo Docampo tdTomato/pTREX-b 68709 Other/Trypanosoma cruzi none S. ...

...ATCACAGTGATGCTCGTCAA cut S. pyogenes 26479191 Kim tdtomato Synthetic CGAAATGAGAAAGGGAGCTACAAC 47869 cut N...