We narrowed to 603 results for: REV
-
TypeBlog PostPublishedSept. 1, 2015, 2:30 p.m....your success. Therefore, it only makes sense to reverse engineer your budgetary needs from your experimental...going through some of the questions we mentioned previously. There is value in the process of creating a...
-
Hot Plasmids: Spring 2025
TypeBlog PostPublishedJune 3, 2025, 1:15 p.m....retrotransposon insertion, a combined endonuclease-reverse transcriptase uses homology arms flanking an RNA...repair (HDR), and insertion is scarless, unlike previous integrase-based approaches. Find STITCHR plasmids... -
CRISPR 101: Off-Target Effects
TypeBlog PostPublishedFeb. 8, 2024, 2:15 p.m..... Of note, most of these optimized Cas enzymes prevent cutting at mismatched guide sites, but not necessarily...alternative pathways. See (Guo et al, 2023) for a review of other targeted sequencing methods. Candidate... -
A Control for All Seasons
TypeBlog PostPublishedOct. 5, 2023, 1:15 p.m....an alternative but well-studied kinase known to prevent tau hyperphosphorylation. You could run brain samples...means an exhaustive list and we encourage you to review the literature for your specific experimental technique... -
Recombinase-based State Machines Enable Order-dependent Logic in vivo
TypeBlog PostPublishedJuly 28, 2016, 2:30 p.m....excluded from the system), these reactions are irreversible. Once expression of a particular recombinase... gene on a register. The purpose of this is to prevent interference between the transcribed gene and its... -
Plasmids 101: Restriction Cloning
TypeBlog PostPublishedFeb. 18, 2016, 3:42 p.m.... anneal to the backbone in either a forward or reverse orientation so you’ll need some way to verify that...digestion, you will need to use a phosphatase to prevent re-circularization of the backbone plasmid (see... -
Important Considerations When Using AAVs
TypeBlog PostPublishedJune 13, 2017, 2:30 p.m....really does not take much time at all. Much of the previous literature using AAVs for DREADD delivery indicates... of neurons showing a very specific phenotype. Previous neural tracing methods used viruses that were ... -
Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering
TypeBlog PostPublishedDec. 15, 2016, 3:57 p.m....modification with an ssDNA substrate. Gam: Gam prevents both the endogenous RecBCD and SbcCD nucleases...repressor gene, CI857, is used. This mutant repressor prevents expression of the recombination genes at low temperatures... -
Live and Let Dye: Self-Labeling Protein Tags
TypeBlog PostPublishedApril 16, 2024, 1:15 p.m....super-resolution imaging of ER and mitochondria reveals dynamic organelle interactions. a) Labeling scheme...filament assembly-regulating proteins in vitro reveals complex events. a) Micrographs of a fluorescently-labeled... -
Antibodies 101: Validation
TypeBlog PostPublishedMarch 24, 2022, 1:15 p.m.... should review before using an antibody. Antibodies and Reproducibility First, let’s review why validation... -
Typing CRISPR Systems
TypeBlog PostPublishedMarch 18, 2025, 1:15 p.m....evolutionary classification of CRISPR–Cas systems. Nature Reviews Microbiology, 13(11), 722–736. https://doi.org/... burst of class 2 and derived variants. Nature Reviews Microbiology, 18(2), 67–83. https://doi.org/10.1038... -
Which Fluorescence Microscopy Technique is Best for Me?
TypeBlog PostPublishedOct. 10, 2017, 1:57 p.m....Single Molecule Localization (PALM/STORM), or Reversible Saturable Optical Linear Fluorescence Transitions.... Lens-based fluorescence nanoscopy. Quarterly reviews of biophysics 48, 178-243 (2015). PubMed PMID: ... -
Custom CRISPR Screens & the Green Listed Software
TypeBlog PostPublishedJuly 11, 2017, 2:30 p.m....the original reference library, as well as GC%, reverse compliment sequences, and more. Output_Compact:...Wang, Tim, et al. "Gene essentiality profiling reveals gene networks and synthetic lethal interactions... -
Antibodies 101: Designing Your First Flow Panel
TypeBlog PostPublishedMay 28, 2024, 1:45 p.m....excitation. After a short period, the electrons revert to a lower energy state, whereby a photon is emitted...markers they label) can occur. As I mentioned previously, you can also use fluorescent reporters, such... -
Antibodies 101: Flow Cytometry
TypeBlog PostPublishedJuly 20, 2021, 1:15 p.m....preparation, staining procedures, and controls. To prevent instrument clogs, ensure that samples are single... LA (1972) Fluorescence Activated Cell Sorting. Review of Scientific Instruments 43:404–409 . https://... -
Delivery Methods for Generating iPSCs
TypeBlog PostPublishedApril 17, 2018, 1:37 p.m.... stem cells: reprogramming à la carte." Nature Reviews Genetics 12, no. 4 (2011): 231-42. PubMed PMID:...reference. 1. Malik, Nasir, and Mahendra S. Rao. "A Review of the Methods for Human iPSC Derivation." Methods... -
CRISPR/Cas9 FAQs Answered!
TypeBlog PostPublishedMarch 13, 2014, 4:08 p.m....primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16: Why does the PX260 ...D., Lin, C., Gootenberg, J. S., Konermann, S., Trevino, A. E., Scott, D. A., Inoue, A., Matoba, S., Zhang... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog PostPublishedSept. 28, 2020, noon...expression of a catalytically dead Cas9 enzyme allows reversible repression based on the presence of the inducer...modulation. CRISPRa from sigma-54 promoters Noting that previous work in bacterial CRISPRa had focused on sigma... -
2022 Depositor Week
TypeBlog PostPublishedDec. 12, 2022, 2:15 p.m....depositing their data with us through our newly revamped Data Hub! The community needs more data-sharing... -
The 12 Days of CRISPR
TypeBlog PostPublishedJan. 3, 2023, 2:15 p.m....Addgene gave to me: Functional Genetic Variants Revealed by Massively Parallel Precise Genome Editing (... -
Addgene is Stopping Use of X (formerly Twitter)
TypeBlog PostPublishedJan. 11, 2024, 2:15 p.m....away from the functionality and features that previously made the platform a mainstay of conversation ... -
Trends in CRISPR and SynBio Technologies
TypeBlog PostPublishedFeb. 4, 2015, 3:58 p.m....on CRISPR and synBio plasmid sharing In a recent review on CRISPR technology, for example, the authors ... -
New FLIS Plasmid (April Fools 2022)
TypeBlog PostPublishedApril 1, 2022, 1:15 p.m...., the Phuels lab deposited a plasmid that will forever change the fly lab experience. The Frequency Light... -
Find and Share AAV Data with Addgene's New AAV Data Hub
TypeBlog PostPublishedOct. 8, 2019, 12:33 p.m....promoter, or tool type. Drilling into any entry will reveal additional data including the subject’s age at ... -
Top Requested Plasmid of 2017 - pMD2.G
TypeBlog PostPublishedJan. 10, 2018, 4:13 p.m....evolving, but sometimes a technology is so useful it forever enhances biological research and discovery. CRISPR... -
Activate Addgene's "Find Plasmids" Badge on Pubmed Abstracts
TypeBlog PostPublishedMay 12, 2017, 12:58 p.m....Up with the Literature How to Write a Scientific Review Article Tips for Improving Your Next Manuscript... -
PEI Calculator for Planning AAV Packaging Transfections
TypeBlog PostPublishedJan. 23, 2018, 2:04 p.m....Preparation is a key step to any experiment and can help prevent future headaches. To help you plan PEI transfections... -
#DeckTheLab with Tinsel and Test Tubes, Fa La La La La La La La La
TypeBlog PostPublishedDec. 2, 2021, 2:15 p.m....winners for each edition and the winners will be revealed on Twitter and Instagram shortly after. Have fun... -
Countdown to Halloween @Addgene
TypeBlog PostPublishedOct. 29, 2014, 5:26 p.m....evidence was destroyed to protect the innocent revelers. Our Halloween costume contests have become an... -
AAV Packaged on Request is Here!
TypeBlog PostPublishedJan. 10, 2025, 1:01 p.m....50 units. Once your request is received, we’ll review for technical and legal compliance, and then send... -
Performing In Vivo CRISPR Screens Using the FITS Approach
TypeBlog PostPublishedMay 2, 2024, 1:15 p.m....tumors, demonstrating that this system can also reveal novel pathways. The FITS deposit also includes ... -
Newly Updated AAV Data Hub!
TypeBlog PostPublishedFeb. 7, 2023, 2:15 p.m....We're excited to roll out the redesigned, revamped, and re-launched Addgene AAV Data Hub, the place for... -
Editor's Choice, October 2016
TypeBlog PostPublishedNov. 4, 2016, 2:30 p.m....form of a discussion between myself and two of my previous graduate school classmates, Ben Vincent and Niroshi... -
Ghanaian Researchers to Receive Plasmid Awards from Addgene and Seeding Labs
TypeBlog PostPublishedJune 15, 2016, 1:30 p.m....second round of plasmid awards on June 15th. As previously, these awards will be open to researchers who... -
Bringing Sustainable Practices to the Lab: Easy Action Items
TypeBlog PostPublishedApril 22, 2019, 12:26 p.m.... Consolidate your autoclave runs. In one of my previous labs, we had a communal tray that everyone could... -
500,000 Plasmids Shipped and Counting!
TypeBlog PostPublishedMarch 26, 2015, 3:24 p.m.... Plasmids start out at our Cambridge office – previously at 1 Kendall Square, but newly relocated to 75... -
Addgene's Website Update
TypeBlog PostPublishedApril 8, 2024, 2:15 p.m...., request, and educational resources page, and previews for our three most recent blog posts. Finally,... -
Making Career Development an Integral Part of the Science Training System
TypeBlog PostPublishedFeb. 25, 2021, 2:15 p.m....which, in the absence of support and structure, prevent science from attracting and keeping diverse talent... -
Your Top Requested Plasmid in 2015!
TypeBlog PostPublishedDec. 30, 2015, 3:30 p.m....have increased lentiviral titer as compared to previous lentiviral vectors. It can be used both to knock-out... -
More Data for You: Find Articles Citing Addgene Plasmids
TypeBlog PostPublishedJune 16, 2015, 2:15 p.m....such as cloning their gene of interest into a previously deposited vector - then you'll find the plasmids... -
Keeping Up With CRISPR/Cas9
TypeBlog PostPublishedMarch 11, 2014, 5:55 p.m....Edit DNA" and "This Protein Could Change Biotech Forever." David S. Weiss of Emory University summed it... -
Save Time and Money by Making Your Own Competent Cells
TypeBlog PostPublishedJan. 28, 2014, 3:10 p.m....obtained using commercially available cells or previous batches of homemade competent cells to ensure ... -
Fluorescent Proteins 101: History of Fluorescent Proteins
TypeBlog PostPublishedAug. 7, 2017, 1:58 p.m....spectrum that GFP and its derivatives did not previously reach. Nobel Prize for fluorescent proteins The... -
Microbes: Look, Listen, and Tell
TypeBlog PostPublishedAug. 28, 2018, 12:04 p.m.... I was once again fascinated by the world that reveals itself when looking down a paper thin and very ... -
Measuring Kinase Activity at the Single-Cell Level with Kinase Translocation Reporters (KTRs)
TypeBlog PostPublishedJuly 26, 2018, 12:46 p.m....residues and the bNLS and NES sequences, which have previously been characterized. See Box 1 in Kudo et al. ... -
Q&A With Julie Cicalese, the Newest Member of the Addgene Board of Directors
TypeBlog PostPublishedMarch 17, 2021, 2:40 p.m....was with us for two months before she found her forever home. I feel blessed that I’m not working so that... -
Why Do I Need an MTA Anyway?
TypeBlog PostPublishedMay 1, 2014, 8:23 p.m.... Right to publish without editorial comment or review by the Provider Limited liability Addgene ... -
Bringing Sustainable Practices to the Lab: Innovations
TypeBlog PostPublishedMarch 7, 2019, 2:39 p.m....Agency, which started making regulations such as preventing manufacturers from dumping hazardous waste directly... -
Our Most Popular Blog Posts from 2019
TypeBlog PostPublishedDec. 31, 2019, 2:26 p.m....CRISPR editing. Using a fusion between Cas9 and reverse transcriptase and a prime editing guide RNA, it... -
What's New in CRISPR - December 2019
TypeBlog PostPublishedDec. 17, 2019, 2:37 p.m....Cytosine deaminase for RNA editing Feng Zhang’s lab previously developed a programmable adenosine-to-inosine...