Skip to main content
Addgene

We narrowed to 3 results for: emx1

Showing: 1 - 3 of 3 results
  1. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    Published
    March 13, 2014, 4:08 p.m.
    ...you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA ...Polymerase for my genomic PCR, but couldn't amplify the EMX1 gene using same primer you used in the Science paper...Takara enzyme is not very robust in this case for EMX1. Since the publication of our paper, we have two...
Showing: 1 - 3 of 3 results