Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 3 of 3 results
  1. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ...you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Why...Polymerase for my genomic PCR, but couldn't amplify the EMX1 gene using same primer you used in the Science paper...Takara enzyme is not very robust in this case for EMX1. Since the publication of our paper, we have two...
  2. Validated gRNA Sequences

    Type
    Collection
    ...pyogenes 24870050 Goncalves Emx1 H. sapiens 42337 cut S. pyogenes 23287718 Zhang EMX1 H. sapiens GAGTCCGAGCAGAAGAAGAA...ATGGCGTGCAGTGCTTCAGC cut S. pyogenes 26789497 Corn EMX1 H. sapiens CGATGTCACCTCCAATGACT cut S. pyogenes ...
Showing: 1 - 3 of 3 results