Zhang Lab's CRISPR Frequently Asked Questions
Type
Collection
...you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Why...Polymerase for my genomic PCR, but couldn't amplify the EMX1 gene using same primer you used in the Science paper...Takara enzyme is not very robust in this case for EMX1. Since the publication of our paper, we have two...