Addgene

This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

We narrowed to 5 results for: emx1

Showing: 1 - 5 of 5 results

Enhancing CRISPR Targeting Specificity with eSpCas9, SpCas9-HF1, & HypaCas9

Type

Blog Post

...mutants. When tested for their ability to cut the EMX1 locus in human embryonic kidney (HEK) cells, 11 ...
Nanoblades: Tiny CRISPR Ninjas for Genome Editing Difficult Cells

Type

Blog Post

...Gene targeted by guide Editing efficiency hiPSCs EMX1 67% Mouse BM cells from GFP transgenic mouse ...
Zhang Lab's CRISPR Frequently Asked Questions

Type

Collection

...you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Why...Polymerase for my genomic PCR, but couldn't amplify the EMX1 gene using same primer you used in the Science paper...Takara enzyme is not very robust in this case for EMX1. Since the publication of our paper, we have two...
Guide RNA Expression Plasmids for Endogenous Human Genes

Type

Collection

...VEGF Site#2 47507 pVC297 VEGF Site#3 47508 pFYF1548 EMX1 47509 pDR366 RNF2 47510 pDR348 FANCF...
Validated gRNA Sequences

Type

Collection

...pyogenes 24870050 Goncalves Emx1 H. sapiens 42337 cut S. pyogenes 23287718 Zhang EMX1 H. sapiens GAGTCCGAGCAGAAGAAGAA...ATGGCGTGCAGTGCTTCAGC cut S. pyogenes 26789497 Corn EMX1 H. sapiens CGATGTCACCTCCAATGACT cut S. pyogenes ...

Showing: 1 - 5 of 5 results