We narrowed to 4 results for: emx1
-
TypeBlog Post...you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA ...Polymerase for my genomic PCR, but couldn't amplify the EMX1 gene using same primer you used in the Science paper...Takara enzyme is not very robust in this case for EMX1. Since the publication of our paper, we have two...
-
Enhancing CRISPR Targeting Specificity with eSpCas9, SpCas9-HF1, & HypaCas9
TypeBlog Post...mutants. When tested for their ability to cut the EMX1 locus in human embryonic kidney (HEK) cells, 11 ... -
Nanoblades: Tiny CRISPR Ninjas for Genome Editing Difficult Cells
TypeBlog Post...Gene targeted by guide Editing efficiency hiPSCs EMX1 67% Mouse BM cells from GFP transgenic mouse ... -
Validated gRNA Sequences
TypeCollection...pyogenes 24870050 Goncalves Emx1 H. sapiens 42337 cut S. pyogenes 23287718 Zhang EMX1 H. sapiens GAGTCCGAGCAGAAGAAGAA...ATGGCGTGCAGTGCTTCAGC cut S. pyogenes 26789497 Corn EMX1 H. sapiens CGATGTCACCTCCAATGACT cut S. pyogenes ...