Skip to main content
Addgene

We narrowed to 4 results for: emx1

Showing: 1 - 4 of 4 results
  1. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...you can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA ...Polymerase for my genomic PCR, but couldn't amplify the EMX1 gene using same primer you used in the Science paper...Takara enzyme is not very robust in this case for EMX1. Since the publication of our paper, we have two...
  2. Validated gRNA Sequences

    Type
    Collection
    ...pyogenes 24870050 Goncalves Emx1 H. sapiens 42337 cut S. pyogenes 23287718 Zhang EMX1 H. sapiens GAGTCCGAGCAGAAGAAGAA...ATGGCGTGCAGTGCTTCAGC cut S. pyogenes 26789497 Corn EMX1 H. sapiens CGATGTCACCTCCAATGACT cut S. pyogenes ...
Showing: 1 - 4 of 4 results