Skip to main content
Addgene

We narrowed to 53 results for: crispr c plasmids

Showing: 1 - 20 of 53 results
  1. Worm Expression Resources

    Type
    Collection
    ... Plasmid Collections Worm Plasmids Worm Plasmids and Resources Plasmid Tools Worm... insertion using CRISPR/Cas9 and the selection of C. elegans strains. CRISPR plasmids from John Calarco's...Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Cloning-free CRISPR for C. elegans , which uses...some of the plasmids and tools available at Addgene for use in worms. Browse Plasmids Plasmid Tools for ...Addgene's CRISPR Guide for a general introduction to CRISPR technology. Addgene's worm CRISPR resources ... PI Plasmids Expressing Worm Genes/Inserts The table below lists plasmids that contain a worm ( C. elegans...Split cGAL plasmids - Paul Sternberg Lab. Plasmids for the temperature-robust GAL4-UAS system in C. elegans...
  2. CRISPR Guide

    Type
    Collection
    ...Figure 7: Overview of CRISPR transposases Browse Plasmids: CRISPR transposases CRISPR Recombinases and Integrases...References Website CRISPR plasmids and resources at Addgene CRISPR 101 eBook (3rd edition) CRISPR software and...Guide CRISPR Guide Jump To: CRISPR Guide Overview CRISPR Basics Small Edits Large Edits Genome-Wide Screening...miRNAs to restrict CRISPR editing only to the target tissue. Browse Plasmids: Anti-CRISPR Small Precision...screening using CRISPR libraries What Are Pooled Lentiviral CRISPR Libraries? Pooled lentiviral CRISPR libraries...modification using CRISPR Browse Plasmids: Epigenetics Visualizing Genomic Loci Using Fluorophores CRISPR imaging...genomic regions using CRISPR Browse Plasmids: Purify Cas9 Alternatives for CRISPR Genome Engineering S....
  3. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...: 95 °C for 15 min, 35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10...following parameters: 37 °C for 30 min; 95 °C for 5 min and then ramp down to 25 °C at 5 °C/min. Dilute oligos...Mammalian Cell Lines Other Addgene Resources CRISPR Plasmids CRISPR Guide Addgene Blog Posts Addgene is proud...usage of the pSpCas9(BB) plasmid (pX330) (Addgene plasmid ID 42230). This plasmid allows for the simultaneous...parameters: Cycles 1-20 (37 °C for 5 min, 20 °C for 5 min); Cycle 21 (80 °C for 20 min). These cycling ...Incubate at 30 - 37 °C for 24 - 72 hr. 30 °C may enhance genome editing efficiency, but 37 °C is acceptable.... CRISPR References & Information Genomic Deletions in Mammalian Cell Lines CRISPR: Protocol...
  4. CRISPR Plasmids - CRISPR Transposases (CAST)

    Type
    Collection
    ...CRISPR Plasmids: CRISPR Transposases (CASTs) Browse CRISPR Plasmids By Function Genome Editing Cut Base... or search the tables below for CRISPR Transposase plasmids. Plasmids are available for expression in ...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...Find plasmids for CRISPR-associated transposases (CASTs) for insertion of donor DNA. CRISPR...Protocols gRNA Design Tools CRISPR Blog Posts CRISPR-associated transposases (CASTs) combine the large-...Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...
  5. CRISPR Plasmids - C. elegans

    Type
    Collection
    ... CRISPR C. elegans CRISPR Plasmids: C. ...Design Tools CRISPR Blog Posts The following CRISPR plasmids have been designed for use in C. elegans. Cut...CRISPR plasmids that have been designed for use in C. elegans. CRISPR...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols.... elegans Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit Transcriptional...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter...expression plasmid based on factors such as selectable marker or cloning method. When using CRISPR, you will...
  6. CRISPR Plasmids - Tagging

    Type
    Collection
    ...and Myers Tagging Plasmids Protein Species Tag Donor Plasmid gRNA plasmid gRNA plasmid FLAG pFETCh_Donor...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...the PITCh system plasmids for CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous...CRISPR plasmids for endogenous tagging of your gene of interest. CRISPR... CRISPR Protein Tagging CRISPR Plasmids...Plasmids - Protein Tagging Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit...Protocols gRNA Design Tools CRISPR Blog Posts The CRISPR system has been adapted to allow tagging of proteins...
  7. CRISPR Plasmids and Resources

    Type
    Collection
    ...bacteria. C. elegans CRISPR plasmids designed for use in C. elegans . Drosophila CRISPR plasmids designed...preps of select CRISPR lentiviral plasmids. CRISPR Plasmid Kits : Find groups of plasmids that are used ...gRNA plasmids to target specific genes. Browse Plasmids by Model Organism Bacteria CRISPR plasmids designed... Mammalian CRISPR plasmids designed for use in mammalian systems. Parasites CRISPR plasmids designed for... parasites. Plant CRISPR plasmids designed for use in plants. Yeast CRISPR plasmids designed for use in...yeast. Xenopus CRISPR plasmids designed for use in Xenopus . Zebrafish CRISPR plasmids designed for use...CRISPR plasmids available at Addgene. Search by species and CRISPR function. CRISPR...
  8. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ... CRISPR Cas3 CRISPR Plasmids: Cascade-Cas3... or search the tables below for CRISPR Cascade-Cas3 plasmids. Plasmids are available for expression in...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...Find plasmids for CRISPR-Cas and Cascade for large genomic deletions. CRISPR...Cascade-Cas3 Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit Transcriptional...Protocols gRNA Design Tools CRISPR Blog Posts Cas3 is a unique member of the CRISPR family. After nicking the...to express equally. To combat this, some CRISPR-Cas3 plasmids take an all-in-one approach and include ...
  9. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ... CRISPR Cut CRISPR Plasmids: Cut Browse CRISPR...search the tables below for CRISPR plasmids designed to introduce a DSB. Plasmids are available for expression...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication C. elegans ID Plasmid Gene/Insert...CRISPR plasmids that create double strand breaks in DNA. CRISPR...Protocols gRNA Design Tools CRISPR Blog Posts Fully functional CRISPR/Cas enzymes will introduce a double-strand...Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid Gene/Insert Promoter...
  10. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...CRISPR Plasmids: Base Edit Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit... or search the tables below for CRISPR base editing plasmids. Plasmids are available for expression in...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...CRISPR plasmids for precisely editing DNA bases without inducing a DNA break. CRISPR...Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert...Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Yeast ID Plasmid Gene/Insert...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...
  11. CRISPR Plasmids - Activate Gene Expression

    Type
    Collection
    ...Activate CRISPR Plasmids: Activate Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick...search the tables below for CRISPR plasmids for transcriptional activation. Plasmids are available for expression...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...PI Publication C. elegans ID Plasmid Gene/Insert Promoter PI Publication Yeast ID Plasmid Gene/Insert Promoter...CRISPR plasmids for activating or upregulating gene expression in various model organisms. CRISPR...Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert...Publication Drosophila ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid Gene/Insert Promoter...
  12. CRISPR Plasmids - Yeast

    Type
    Collection
    ... CRISPR Yeast CRISPR Plasmids: Yeast Browse ...Protocols gRNA Design Tools CRISPR Blog Posts The following CRISPR plasmids have been designed for use ...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...CRISPR plasmids that have been designed for use in yeast. CRISPR...Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation ...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter...gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene/Insert Promoter...
  13. Validated gRNA Sequences

    Type
    Collection
    ...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...validated for use in CRISPR experiments. This datatable is compiled from plasmids in Addgene's database...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...
  14. CRISPR Plasmids - Bacteria

    Type
    Collection
    ... CRISPR Bacteria CRISPR Plasmids: Bacteria...following CRISPR plasmids have been designed for use in bacteria. Cut Fully functional CRISPR/Cas enzymes...efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function Genome...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...G (or T->C on the opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR/Cas nickase...CRISPR plasmids that have been designed for use in bacteria. CRISPR...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter...
  15. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...CRISPR Plasmids: Mammalian Expression The following CRISPR plasmids have been designed for use in mammalian...NHEJ. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Browse CRISPR Plasmids By Function...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...CRISPR plasmids that have been designed for use in mammalian systems. CRISPR...evolution. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter...gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene/Insert Promoter...
  16. CRISPR Plasmids - Plants

    Type
    Collection
    ... CRISPR Plants CRISPR Plasmids: ...Protocols gRNA Design Tools CRISPR Blog Posts The following CRISPR plasmids have been designed for use ...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...CRISPR expression plasmids that have been designed for use in plants. CRISPR...: Plants Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit Transcriptional...gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter...gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene/Insert Promoter...
  17. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The CRISPR revolution shows no...out Addgene’s CRISPR Guide and CRISPR blog posts , or find CRISPR plasmids for your research. Addgene has... CRISPR CRISPR History CRISPR History and Development for Genome Engineering You may also like...sequencing, CRISPR is a robust system for genome-wide screening. CRISPR Technological Advances CRISPR technology...finger nucleases (ZFNs) and TALENs. CRISPR: An Adaptive Immune System CRISPR (Clustered Regularly Interspaced...prokaryotes used CRISPR as part of an adaptive immune system - utilizing various CRISPR-associated (Cas...of DNA known as CRISPR arrays. Separate Cas proteins then express and process the CRISPR loci to generate...
  18. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ... CRISPR Pooled Libraries CRISPR Pooled Libraries Browse CRISPR Plasmids By Function Genome...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols... (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 78,637 Broad GPP Humagne Set C and...Protocols gRNA Design Tools CRISPR Blog Posts CRISPR is a useful tool for genetic screening experiments...virtually any genetic locus. CRISPR pooled libraries consist of thousands of plasmids, each containing multiple...experiments using a pooled CRISPR library are far more complex than using CRISPR to modify a single genomic...steps for using pooled CRISPR libraries and keep the following in mind: CRISPR screening experiments require...
  19. Rett Syndrome

    Type
    Collection
    ... using plasmids, please see Addgene's Plasmids for Stem Cell Research page. CRISPR Tools CRISPR technology...Addgene's CRISPR Guide for a general introduction to CRISPR technology or the mammalian CRISPR resources... Syndrome Plasmid Collection and Resource Center MECP2 Animal Models Human Cell Lines CRISPR Tools Plasmids...selection of plasmids expressing Cas9 and empty gRNA backbones. A few examples of additional CRISPR resources...Editing CRISPR-based DNA methylation editing system - Shawn Liu and Rudolf Jaenisch labs Plasmids MECP2 ...MECP2 Plasmids The table below highlights plasmids that express or target the MECP2 gene. Use the search bar...window) C-terminal Anti-MECP2 (M6818) mouse antibody from Sigma (Link opens in a new window) C-terminal...
  20. Plasmids for Stem Cell Research

    Type
    Collection
    ... Plasmid Collections Plasmids for Stem Cell Research Plasmids for Stem Cell Research...Reprogramming Plasmids Differentiation and Transdifferentiation Plasmids Stem Cell Research Plasmids Stem cells...utilize plasmids to increase expression of key factors. The tables below will help you find plasmids available...information page. Reprogramming Plasmids Browse the table below for plasmids used to create induced pluripotent...RNA p53 for single plasmid reprogramming Novel codon-optimized mini-intronic plasmid for efficient, inexpensive...Differentiation and Transdifferentiation Plasmids Browse the table below for plasmids used for differentiation of ...Retinal Ganglion Cells AAV/CRISPR Mouse Glia-to-Neuron Conversion by CRISPR-CasRx Alleviates Symptoms ...
Showing: 1 - 20 of 53 results