Skip to main content
Addgene
Showing: 1 - 20 of 21 results

  1. Serotype Testing AAV

    Type
    Collection
    ...37825-AAV5.T 20 µL $ 140 Add to Cart AAV8 37825-AAV8.T 20 µL $ 140 Add to Cart AAV9 37825-AAV9.T 20 µL $ 140...50465-AAV5.T 20 µL $ 140 Add to Cart AAV8 50465-AAV8.T 20 µL $ 140 Add to Cart AAV9 50465-AAV9.T 20 µL $ 140...Price* AAV1 37825-AAV1.T 20 µL $ 140 Add to Cart AAV2 37825-AAV2.T 20 µL $ 140 Add to Cart AAV5 37825-...Price* AAV1 50465-AAV1.T 20 µL $ 140 Add to Cart AAV2 50465-AAV2.T 20 µL $ 140 Add to Cart AAV5 50465-... Viral Vector Packaging Service AAV Serotype Testing AAV Viral Vector... Vector Packaging Service: Serotype Testing AAV These AAV encode fluorescent reporters and can be used...experiments. For more information, see our full AAV inventory or our AAV production page . Note: For a list of ...

  2. Optogenetics AAV Preps

    Type
    Collection
    ...C1V1 (t/t)-TS-EYFP EF1a C1V1 (t/t) EYFP Cre dependent 9 Deisseroth 35499 pAAV-CaMKIIa-C1V1 (t/t)-TS-EYFP...TS-EYFP CaMKII C1V1 (t/t) EYFP Constitutive 9 Deisseroth 124650 pAAV-CamKIIa-C1V1(t/t)-mScarlet-KV2.1 CaMKII...pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry EF1a C1V1 (t/t) mCherry Cre dependent 9 Deisseroth 105448 pAAV-hSyn-DIO-ChrimsonR-mRuby2...Browse all Optogenetics AAV *AAVrg = retrograde serotype, produced with the AAV retro helper plasmid from...high quality AAV preps from select plasmids in the repository. Browse our optogenetics AAV collection, ...Packaging Service AAV Optogenetics Viral Vector Packaging Service: Optogenetics AAV Optogenetic tools ...CaMKII C1V1 (t/t) mScarlet Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive...

  3. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...You may also like: Viral Service: All AAV Viviana Gradinaru PHP AAV Serotypes Blog: Viral Vectors As part...Y730F, T491V, R487G, R585S, and R588T. AAV6(dbY-F+T-V) The AAV6(dbY-F+T-V) serotype displays enhanced transduction...15;8:184-197. PMID: 28918020 AAV6(dbY-F+T-V) When using the AAV6(dbY-F+T-V) serotype in future publications... The AAV6(dbY-F+T-V) serotype was developed by Arun Srivastava’s lab. It is derived from the AAV6 capsid...We provide high quality AAV preps from select plasmids in the repository. Browse the University of Florida... Viral Vector Packaging Service AAV University of Florida Serotype Testing Panel for ...viral vectors undergo quality control, including AAV titration by ddPCR, in vitro and (when possible) ...

  4. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...Systemic Capsids AAV Packaged on Request AAV Guide Plasmids Publications Enhancer AAV plasmids are plasmids...Institute for Brain Science AAV Enhancer Collection Allen Institute for Brain Science AAV Enhancer Collection ...Barcelli T, Barta S, Bendrick J, Bertagnolli D, Bowlus J, Boyer G, Brouner K, Casian B, Casper T, Chakka...Malone J, Mollenkopf T, Morin E, Newman D, Ng L, Ngo K, Omstead V, Oyama A, Pham T, Pom CA, Potekhina L..., Walker M, Weed N, Wirthlin M, Wood T, Wynalda B, Yao Z, Zhou T, Ariza J, Dee N, Reding M, Ronellenfitch...Find AAV enhancer plasmids for fluorescent labeling and recombination across brain regions and populations...across brain regions and populations using systemic AAV delivery. The collection includes the top vectors...

  5. Cre-lox system

    Type
    Collection
    ...107312 AAV-hSyn-mCherry-P2A-Cre-WPRE mCherry and Cre; expressed in neurons hSyn AAV Yang 107313 AAV-aCamkII-mCherry-P2A-Cre-WPRE-BGH-polyA...Lentiviral Eisenhoffer 132551 AAV-U6-gRNA-TnT-Cre Cre Chicken cardiac troponin T AAV Pu 134308 pCAG-Synaptophysin-TdTomato-IRES2...Deisseroth 55635 pAAV-EF1a-sCre SCre EF-1 alpha AAV Deisseroth 55636 pAAV-EF1a-Cre Cre EF-1 alpha AAV Deisseroth...CamKII AAV Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Cre hSyn AAV Wilson 105555 pENN.AAV.hSyn.Cre.hGH Cre ...51507 AAV pmSyn1-EBFP-Cre Cre-EBFP fusion; Expression in neurons. synapsin AAV Zeng 51904 paavCAG-iCre ...iCre CAG AAV Kim 55632 pAAV-Ef1a-mCherry-IRES-Cre Cre and mCherry coexpression EF-1 alpha AAV Deisseroth...EGFP-Cre fusion hSyn AAV Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 EGFP-Cre fusion CMV AAV Wilson 105550 ...

  6. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...C1V1 (t/t)-TS-EYFP Optogenetics Karl Deisseroth AV-9-35498M 100061-AAV9 pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry...-9-PV2453 45185-AAV9 AAV-EF1a-BbTagBY Control Joshua Sanes AV-9-PV2454 45186-AAV9 AAV-EF1a-BbChT Control...Deisseroth AV-9-35499 35499-AAV9 pAAV-CaMKIIa-C1V1 (t/t)-TS-EYFP Optogenetics Karl Deisseroth AV-9-35505 ...18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2-Venus-AAV Karel Svoboda...18916P 18916-AAV9 AAV-FLEX-rev-ChR2(H134R)-mCherry Scott Sternson AV-9-18917P 18917-AAV9 AAV-FLEX-rev-ChR2... AV-5-PV2432 22222-AAV5 AAV-FLEX-Arch-GFP Ed Boyden AV-1-ALL864 51503-AAV1 AAV pCAG-FLEX-tdTomato-WPRE...1-27056 27056-AAV1 pAAV-Ef1a-DIO EYFP Control Karl Deisseroth AV-1-ALL854 51502-AAV1 AAV pCAG-FLEX-EGFP-WPRE...

  7. Luciferase Plasmid Collection

    Type
    Collection
    ...Firefly luciferase gene.. TREAT (3( T hree)′- R NA E nd A ccumulation during T urnover) : Single-molecule mRNA...William Hahn, David Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase...luciferase with a V5 tag Kevin Janes 83281 pAAV-CAG-FLuc Firefly CAG AAV expression of firefly luciferase Mark...Mark Kay 105532 pAAV.CMV.ffLuciferase.SV40 Firefly CMV AAV expression of firefly luciferase James Wilson...transfection Sidi Chen 118412 ssAAV-EF1a-FLuc-WPRE-HgHpA_bac_293 Firefly EF1α AAV expression of firefly luciferase...luciferase Rudolf Jaenisch 105538 pENN.AAV.TBG.PI.ffLuciferase.RBG Firefly TGB AAV expression of firefly luciferase...luciferase Paul Schulze-Lefert 83282 pAAV-CAG-RLuc Renilla CAG AAV expression of renilla luciferase Mark...

  8. AAV for Neuronal Tracing

    Type
    Collection
    ... Tracing These AAV encode tools for rabies virus-based monosynaptic tracing. These AAV can be used with...steps for using AAV and modified rabies virus (RABV) for monoclonal neuronal tracing. (1) AAV encoding TVA...deletion-mutant rabies virus AAV1 Wickersham 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA These AAV together can be used...virus. AAV Vectors for Monosynaptic Neuronal Tracing ID Name Description Serotype PI 52473 pAAV-synP-FLEX-splitTVA-EGFP-B19G...Ready-to-use AAV available from Addgene's viral service encoding tools for monosynpatic retrograde neuronal... Viral Vector Packaging Service AAV Monosynaptic Neuronal Tracing Viral Vector Packaging...to the starter cell in trans , via delivery by an AAV. Since this starter cell now has all the viral genes...

  9. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... smaller than SpCas9 and more easily packaged in AAV. Cas9 orthologs also have distinct PAM sites that...also makes it suitable for multiplexing and use in AAV. Scientists have also developed CRISPR editing technologies... Biotechnol . 32(3):279-84. PMID: 24463574 Fujita T, Fujii H. 2013. Efficient isolation of specific genomic...A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. 2015. Multicolor CRISPR labeling of chromosomal loci...Naseri A, Huisman M, Zhang S, Grunwald D, Pederson T. 2016. Multiplexed labeling of genomic loci with dCas9...Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. 2014...specificity. Science . 351(6268):84-8. PMID: 26628643 Wang T, Wei JJ, Sabatini DM, Lander ES. 2014. Genetic Screens...

  10. Tetracycline Inducible Expression

    Type
    Collection
    ...The new transactivator rtTA ( r everse t etracycline-controlled t rans a ctivator) was created by fusing...expression in mammalian cells. Yao F, Svensjö T, Winkler T, Lu M, Eriksson C, Eriksson E. Hum Gene Ther...pTREtight promoter None Either Elledge 35625 pAAV-Ptet-RFP-shR-rtTA AAV; shRNA cloning vector; for evaluation... interest. tTA Off Sabatini 92099 AAVS1_Puro_Tet3G_3xFLAG_Twin_Strep Bidirectional promoter controls expression...System. Contains homology arms for integration into AAVS1 Genomic Safe Harbor Locus. Tet-On 3G On Doyon 58245...

  11. CRISPR Guide

    Type
    Collection
    ...INTEGRATE ( I nsertion of T ransposable E lements by G uide R NA- A ssisted T argeting), developed by Samuel...Topkar, V. V., Nguyen, N. T., Zheng, Z., Gonzales, A. P. W., Li, Z., Peterson, R. T., Yeh, J. J., Aryee, M...PMID: 28041849 Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., & Yamamoto, T. (2014). Multiplex genome... R. T., Silverstein, R. A., Amrani, N., Peng, C., Kramme, C., Savic, N., Pacesa, M., Rodríguez, T. C.,... (22), 5635-5652.e29. PMID: 34653350 Chu, V. T., Weber, T., Wefers, B., Wurst, W., Sander, S., Rajewsky... Gao, L., Cox, D. B. T., Yan, W. X., Manteiga, J. C., Schneider, M. W., Yamano, T., Nishimasu, H., Nureki...Y., Nakada, S., Yamamoto, T., Sano, S., Hotta, A., Takeda, J., & Mashimo, T. (2019). CRISPR-Cas3 induces...

  12. Mammalian RNAi Tools

    Type
    Collection
    ... a lentiviral backbone, with some retroviral and AAV backbone options. Plasmids for constitutive expression...window) . Moore, C. B., Guthrie, E. H., Huang, M. T., Taxman, D. J. (2010). Short hairpin RNA (shRNA):...

  13. Retrovirus Plasmids

    Type
    Collection
    ...γ-Retrovirus Guide Biosafety Guide Lentiviral Plasmids AAV Plasmids Viral Vectors 101 eBook γ-Retrovirus (gamma-retrovirus...1780 pBABE-neo largeTcDNA MoMLV Expression of Large T antigen for creation of immortalized cells (see Weinberg...

  14. Plan Your Experiment

    Type
    Collection
    ... screens using CRISPR AAV transduction CRISPR elements are inserted into an AAV transfer vector and used...used to generate AAV particles (for details, see our AAV Guide ) ∼4.5 kb packaging limit (only compatible.../or gRNA Infects dividing and non-dividing cells AAV is the least toxic method for in vivo viral delivery...197–217. PMID: 25408407 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables the efficient mRNA...

  15. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP NA Cytoplasm 101781 CETN2-mTagRFP-T AICSDP-22 mTagRFP-T Centrin-2...PMP34 Peroxisomes 101785 TUBA1B-mTagRFP-T AICSDP-28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1... Sarcomeric z-disks 124608 NPM1-mTagRFP-T AICSDP-69 mTagRFP-T Nucleophosmin Nucleolus (granular component...114403 LMNB1-mTagRFP-T AICSDP-29 mTagRFPT Lamin B1 Nuclear envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36...References Roberts B, Haupt A, Tucker A, Grancharova T, Arakaki J, Fuqua MA, Nelson A, Hookway C, Ludmann...mEGFP Ras-related protein Rab-5A Endosomes 107580 AAVS1-mTagRFPT-CAAX AICSDP-42 mTagRFPT CAAX domain of ...

  16. Deisseroth INTRSECT Collection

    Type
    Collection
    ...targeting strategy that allows adeno-associated virus (AAV)-borne payloads to be expressed in cells based on... Chuhma N, Mingote S, Yetnikoff L, Kalmbach A, Ma T, Ztaou S, Sienna AC, Tepler S, Poulin JF, Ansorge ...Müller K, Fenno L, Kim YS, Ramakrishnan C, Andrási T, Deisseroth K, Holmes A, Hájos N. 2019. Excitation... C, Dorrier CE, Tipton GJ, Ramakrishnan C, Kozicz T, Deisseroth K, Thiele TE, McElligott ZA, Holmes A,... Items 55636 pAAV-EF1a-Cre None Yes 55632 pAAV-Ef1a-mCherry-IRES-Cre None Yes 55637 pAAV-EF1a-Flpo None...None Yes 55634 pAAV-EF1a-mCherry-IRES-Flpo None Yes 55638 pAAV-EF1a-vCre None Yes 55635 pAAV-EF1a-sCre None...Items 55641 pAAV-Ef1a-fDIO EYFP Flp Yes 55640 pAAV-Ef1a-dDIO hChR2(H134R)-EYFP Dre No 55639 pAAV-Ef1a-fDIO...

  17. Immunology Research Plasmids and Resources

    Type
    Collection
    ... TRAJ10 T cell receptor alpha joining 10 - TRAJ11 T cell receptor alpha joining 11 - TRAJ12 T cell receptor... TRAJ13 T cell receptor alpha joining 13 - TRAJ14 T cell receptor alpha joining 14 - TRAJ15 T cell receptor... TRAJ16 T cell receptor alpha joining 16 - TRAJ17 T cell receptor alpha joining 17 - TRAJ18 T cell receptor... TRAJ20 T cell receptor alpha joining 20 - TRAJ21 T cell receptor alpha joining 21 - TRAJ22 T cell receptor... TRAJ23 T cell receptor alpha joining 23 - TRAJ24 T cell receptor alpha joining 24 - TRAJ25 T cell receptor... TRAJ26 T cell receptor alpha joining 26 - TRAJ27 T cell receptor alpha joining 27 - TRAJ28 T cell receptor...- TRAJ29 T cell receptor alpha joining 29 - TRAJ3 T cell receptor alpha joining 3 - TRAJ30 T cell receptor...

  18. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pX601 61591 Mammalian/AAV BsaI yes, cut S. aureus Zhang pX602 61593 Mammalian/AAV BsaI yes, cut S. aureus...pyogenes Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes...pyogenes mCherry Kuhn AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR 60229 Mammalian/AAV SapI none S. pyogenes...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV SapI none...pyogenes Zhang AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR 60226 Mammalian/AAV SapI none S...particular expression system , eg. Mammalian, Lentiviral, AAV, Bacteria, Drosophila, Yeast, Plant, Xenopus, Worm... none S. pyogenes Gersbach PX552 60958 Mammalian/AAV SapI none S. pyogenes Zhang pgRNA-humanized 44248...

  19. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...113584 (EFS) 113585 (TBG) Knockout Mouse Chen N/A (AAV) 4 286 Mouse Validation (mVAL) CRISPR Library 159391...Prime Editing Other Species Human Mouse Fly Yeast T. gondii E. coli S. pneumoniae M. tuberculosis M. smegmatis...Moffat 3rd 4 70,948 Toxoplasma Knockout 80636 Knockout T. gondii Lourido N/A 10 8,158 Turner Lab Human messenger-RBP...

  20. Validated gRNA Sequences

    Type
    Collection
    ...48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola...TGAAGAAAGTTATACTCGA 66099 cut S. pyogenes 25249454 Seydoux T (BRACHYURY) H. sapiens CACGCGCAGTTCGCGCTCTG 59726 ...69239 cut S. pyogenes 26480473 Wolfe TGME49_290860 T. gondii ATTGGTCTGACAGCGATGTG 59855 cut S. pyogenes...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens... 26997482 Yeo AAVS1 H. sapiens TGTCCCTAGTGGCCCCACTG cut S. pyogenes 26789497 Corn AAVS1 H. sapiens ACAGTGGGGCCACTAGGGAC...GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758 Sabatini AAVS1 H. sapiens GTCCCCTCCACCCCACAGTG 41817 cut S. pyogenes...
Showing: 1 - 20 of 21 results