We narrowed to 117 results for: LIS
-
TypeCollection...Please note that the following table lists both published and unpublished plasmids containing gRNA sequences... Design Tools CRISPR Blog Posts The table below lists gRNA plasmids designed to target various genes or...deposit process and have your plasmids added to the list. You can also email [email protected] for more information... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...
-
Rett Syndrome
TypeCollection...Mouse line with conditional deletion of Xist Unpublished Joost Gribnau Human Cell Line Models Induced ....806delG 806delG G269Afs*20 M Fibroblasts & iPSC Unpublished (Link opens in a new window) Wendy Gold A140V...A140V C419T A140V M Fibroblasts Unpublished (Link opens in a new window) Wendy Gold AN_BU 808delC Arg270Glufs...Arg270Glufs*19 F Fibroblasts & iPSC Unpublished (Link opens in a new window) Wendy Gold BO_DI 806delG G269Afs...G269Afs*20 F Fibroblasts Unpublished (Link opens in a new window) Wendy Gold HO_AN G917A R306H F Fibroblasts...Fibroblasts Unpublished (Link opens in a new window) Wendy Gold For more information on generating iPSCs using...Link opens in a new window) ClinicalTrials.gov - a list of Rett syndrome clinical trials (Link opens in ... -
Synthetic Biology - Overview
TypeCollection...George Church Cynthia Collins James Collins Tom Ellis Drew Endy Tobias Erb Susan Golden John Gray Jeff...Maharbiz Thorsten Mascher Kathleen Matthews Anastasios Melis Aindrila Mukhopadhyay Richard Murray Erin O'Shea..., integration, reporter, and tagging vectors. Metabolism Browse plasmids related to metabolic pathways... Circuit Transfer C. Collins Lab Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... -
Microbiology Resources
TypeCollection...for specific genes or applications that are not listed here. Addgene Microbiology Resources Plasmid Kits...sp. Haemophilus influenzae Helicobacter pylori Listeria monocytogenes Mycobacterium sp. Neisseria sp. ...West Nile virus (WNV) Zika Don’t see your field listed? Know of some great plasmid tools for the community...Heterologous protein expression in E. coli, B. subtilis and P. pastoris - Gomis-Rüth Lab pOSIP plasmid... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... -
Bacterial Expression Systems
TypeCollection... of Cas9 nuclease gRNA. For a more comprehensive list of our bacterial CRISPR plasmids, see here . pwtCas9...double stranded breaks. For a more comprehensive list of our bacterial CRISPR plasmids, see here . pgRNA-bacteria...disruption or knockdown. For a more comprehensive list of our bacterial CRISPR plasmids, see here . pGRG... and lacO variants that can be expressed in B. subtilis Various combinations of N and C-terminal Strep... express a protein of interest in E. coli , B. subtilis and P. pastoris . All plasmids use the same restriction... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... -
Arf GTPase Family
TypeCollection...ARF GTPase Plasmids by Gene The following table lists genes in the ARF GTPase family, information on each...available for each gene. Click the gene name for a full list of plasmids available. Please note that some genes...GAP and GEF Plasmids by Gene The following table lists genes in the ARF GAP and GEF family, information... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... -
Plasmids for Stem Cell Research
TypeCollection...expression of human L-Myc, Lin28, Sox2, Klf4, Oct3/4, Glis1, and EBNA1 from separate plasmids An Efficient Non-viral...from three separate plasmids A Facile Method to Establish Human Induced Pluripotent Stem Cells From Adult...expressing human Oct4, Klf4, Sox2, with either c-Myc or Glis1 Efficient generation of human iPSCs by a synthetic...differentiation of iPSCs into cortical and motor neurons. Unpublished. Ward Glial Progenitor Cells GABAergic Interneurons... Research Plasmids This table contains a general list of plasmids that have been used in Stem Cell research... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... -
Zhang Lab's CRISPR Frequently Asked Questions
TypeCollection...article from Dr. Feng Zhang's Lab, has assembled a list of FAQs about using the lab's CRISPR technology....Lab ( Science , February 2013 ), has assembled a list of FAQs about using the lab's CRISPR technology....from the Zhang group . Many protocols have been published with thorough step-wise instructions on designing...references. For genome editing, the Zhang lab has published this Nature Protocol article . Should I add the...optimized primers that may work better than the published ones, so if/when you use HercII or Kapa Hifi the... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...A list of zebrafish genes and associated pairs of zinc finger arrays that can be used to generate ZFNs... for Endogenous Zebrafish Gene Targets Recent published reports have shown that engineered zinc finger...targeted to various zebrafish genes. The table below lists zebrafish genes and associated pairs of zinc finger...details). IMPORTANT NOTE: All zinc finger arrays listed show transcriptional activation activity of three-fold... -
Worm Expression Resources
TypeCollection... not included in this table. For a more complete list of plasmids that can be used in worms, search Addgene's...Plasmids Expressing Worm Genes/Inserts The table below lists plasmids that contain a worm ( C. elegans, C. briggsae...: ID Plasmid Gene/Insert PI Don’t see your gene listed? Know of some great plasmid tools for the community... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... -
Zebrafish Plasmid Collection
TypeCollection... fish in the minnow family. It has long been established as a powerful vertebrate model organism for the... Tracing during Development and Regeneration - Periklis Pantazis Lab Multibow: digital spectral barcodes...optogenetics to tools for studying diseases, are listed below: Lipid droplet reporters - Richard White ... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... -
Ras Pathway
TypeCollection...Pathway Background Ras Pathway Plasmids Ras Gene List Resources Background Ras is a small GTPase and is...available plasmids for the gene, or browse the gene list below. For proteins with multiple subunits or isoforms...Cancer Research Return to top Ras Pathway - Gene List Click on a name to find available plasmids for the... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... -
Validated gRNA Sequences
TypeCollection... Design Tools CRISPR Blog Posts The table below lists gRNA sequences that have been experimentally validated...experiment as described in the associated article (listed below by PubMed ID). These factors include: Does...the Cas9 application the gRNA was designed to accomplish. Validated gRNA Sequence Datatable Target Gene... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740... -
Synthetic Biology - Browse Plasmids
TypeCollection...A list of Addgene plasmids for use in synthetic biology applications, or from synthetic biology labs....Standards SynBio Blog Genome Engineering Browse the list of available plasmids related to synthetic biology...are plasmids you would like to see added to this list, please email [email protected] . Synthetic Biology... -
TALEN Expression Vectors
TypeCollection...Daniel Voytas Lab plasmids CRISPR plasmids This page lists plasmid vectors into which DNA fragments encoding... products are the same). All expression vectors listed below have the CMV promoter for mammalian cell ...at their amino-terminus. The expression vectors listed below can be purchased together with the Joung ... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...present in many circulating variants. The table below lists expression plasmids that are suitable for generating...measuring infectivity and neutralizing activity are listed below: pBOBI-FLuc - Lentiviral reporter vector ... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... -
Penn Vector Core Partnership with Addgene
TypeCollection...partnership to provide AAV viral preps, includes listing of transfer status for viral preps....vectors for distribution via Addgene. For a full list of Addgene's viral vectors See Addgene's Current...some viral vectors have been discontinued. See the list of discontinued viral vectors . The following vectors...information. Plasmids are available for all the items listed below. Please let us know (Link opens in a new ... -
AAVED
TypeCollection... Please see our list of suggested materials below. Suggested materials to share: List of papers in which...images on best practices (e.g., dose response data, list of antibodies and recommended dilutions, etc.), ... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...Packaging Plasmids The following tables contain a list of packaging plasmids that are useful to produce...Mutations PI AAV Plasmids This table contains a general list of plasmids that encode the AAV genome (i.e., the... for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... -
AAV Packaged on Request
TypeCollection...package plasmids in our collection in the serotypes listed here. Details Scale and Titer Packaged on Request...often goes unshared, bridging the gap between published methods and real-world troubleshooting. Eligible...with troubleshooting and results that complement published data, capturing the insights that often go unshared...