Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 84 results for: Met

Showing: 21 - 40 of 84 results

  1. TALEN Engineering

    Type
    Collection
    ...Ligation) assembly method (Sander et al., Nat Biotechnol. 2011), the REAL-Fast assembly method (Reyon et al....effectors, including designed TALENs, and assembly methods for REAL, REAL-Fast and FLASH Genome...Automatable Solid-phase High-throughput) assembly method (Reyon and Tsai et al., Nat Biotechnol 2012). All...architectural framework and the DNAs produced by all three methods are identical in sequence. TAL effector repeat ...activators in human cells ( Maeder et al., Nat Methods 2013 ) More detailed information about REAL, REAL-Fast...

  2. Zinc Finger Consortium: OPEN Reagents

    Type
    Collection
    ...the Materials and Methods of your future publications. For your Materials and Methods section: "The plasmid...Plamids for Oligomerized Pool ENgineering (OPEN) method has been used to engineer ZFNs that function in...ZFNs via the Oligomerized Pool ENgineering (OPEN) method. This kit consists of 5 individually packaged plasmids...2009 Sep 17. PubMed . Description Use of the OPEN method requires OPEN pools (available by request from ...2000 ). The Oligomerized Pool ENgineering (OPEN) method has been used to engineer ZFNs that function in...

  3. Antibody Production

    Type
    Collection
    ...are initially titered by spectrophotometry using a NanoDrop spectrophotometer. If needed, the sample is...Overview of Addgene's antibody production methods and quality control processes for purified recombinant... scientists. They are generated using standard methods individually optimized for each specific antibody...Details about our production protocols, titering methods, and quality control are described below. Information...PCR product is purified, sequenced via the Sanger method, and aligned with the parental plasmid sequence...

  4. TALEN Expression Vectors

    Type
    Collection
    ...FLASH assembly methods can be found on the TALengineering website . All three of these methods yield TAL effector...arrays assembled using the REAL, REAL-Fast or FLASH methods TALengineering... (assembled using the REAL, REAL-Fast or FLASH methods) can be cloned for expression as TALENs. Additional... of the assembly are different among the three methods, the final products are the same). All expression...

  5. Antibody Plasmid Collection

    Type
    Collection
    ... and Evolving Functional Proteins. METHODS: A Companion to Methods in Enzymology 8, 94–103 (1995). Carlos...Monoclonals with Engineered Immune Effector Functions. Methods Mol Biol. 2018;1827:313-334. Daniel Christ pComb3...diabody and Fab fragment libraries from chickens Methods for the generation of chicken monoclonal antibody...antibody fragments by phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas Vector ...

  6. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TCTTCTTGTGCTCTTATTggcaggtacctggtgacTCACCTTATGGGCGCTGA matrixmetallopeptidase15 (membrane-inserted) TAL3484 & TAL3485 ...TGATCTGTTCCTGGTAGCcgttcatgagctgggcCATGCCCTTGGACTGGAA matrixmetalloproteinase14a (membrane-inserted) TAL3486 & TAL3487...TTGCTCCTTGGTTGCATCtctgtcttcattatcaCAAACATTTTCTTCATTA tetmethylcytosinedioxygenase 1 TAL3572 & TAL3573 TCAACTCGCGCATCCACAaagcgaaatgttaagaGGGTGAAGGCTTCCATGA...TCAACTCGCGCATCCACAaagcgaaatgttaagaGGGTGAAGGCTTCCATGA tetmethylcytosinedioxygenase 3 TAL3574 & TAL3575 TTATTAGGCACTTTTTTGtaaacgctgtattccaTGCACTTTCCTGTCCACA...TTATTAGGCACTTTTTTGtaaacgctgtattccaTGCACTTTCCTGTCCACA tetmethylcytosinedioxygenase 3 (previous si:ch211-220a11.1) TAL3576...

  7. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    .... Below are some common delivery methods. Delivery method Advantages Representative Empty ...Inducible gene expression under the metallothionein promoter pFastBac LIC and pFastBac Dual LIC...our dedicated Cre-lox Plasmids page pBF3060 - Metabolic engineering in S. cerevisiae TALENs Gene targeting... Selectable Markers Regardless of your delivery method, it's unlikely that all of your cells will...

  8. mTOR Pathway

    Type
    Collection
    ...J, Kim SG, Blenis J. Cell Metab. 2014 Mar 4;19(3):373-9. doi: 10.1016/j.cmet.2014.01.001. PubMed PMID:...mTOR pathway. enhanced signaling of mTOR, a key metabolic regulator, correlates with poor prognosis in many...ammalian t arget o f r apamycin (mTOR) is a key metabolic regulator controlling cell growth and proliferation...

  9. Plant Plasmids and Resources

    Type
    Collection
    ...promoter or cloning method of choice. ID Plasmid Description Promoter Cloning Method PI Return to top Fluorescent...synthetic operons for chloroplast transformation and metabolic engineering in plants (including tobacco and potato... opens in a new window) - Transcriptomic and metabolomic resources for 14 key medicinal plants for the...

  10. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...histone demethylation by LSD1, cytosine methylation by DNMT3A or MQ1, and cytosine demethylation by Tet1...on factors such as selectable marker or cloning method. To isolate mammalian vectors, simply type "Mammalian...

  11. CRISPR Plasmids - Tagging

    Type
    Collection
    ...tagging methods allow for improved efficiency and throughput over traditional tagging methods. Several...developed a simple and scalable CRISPR/Cas-based method to tag endogenous proteins by using donor constructs...Seydoux's lab has developed a systematic and scalable method to create marker-free mutations, insertions, and...

  12. COVID-19 Resources

    Type
    Collection
    ...membrane fusion function.( 5 ) TACE - (ADAM17) a metalloprotease that cleaves hACE2, potentially increasing ...of the Cas13 protein to develop and optimize the method termed Specific High Sensitivity Enzymatic Reporter...s non-specific ssDNA degradation to develop the method termed DNA Endonuclease Targeted CRISPR Trans Reporter...Protocols relevant to SARS-CoV-2 Research Coronavirus Method Development Community at Protocols.io Addgene's...

  13. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR 71667 Mammalian U6 yes, methylation S. pyogenes...pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes, methylation S. pyogenes Puro Zoldos pBLO1811_Cas9_noNLS_human...expression cassette using the Golden Gate cloning method. A separate accessory pack is available for dCas9... in this Golden Gate and Gateway based assembly method: plasmids for assembly of single gRNA vectors with...

  14. Deisseroth INTRSECT Collection

    Type
    Collection
    ...payloads in target populations defined by multiple parameters....payloads in target populations defined by multiple parameters. Figure 1: Examples of intersectional cell population...combination of genetic and/or anatomical-defined parameters, by placing two orthogonal recombinase (Cre and...vectors using multiple-feature Boolean logic. Nat Methods 11(7):763-72. PubMed (Link opens in a new window...

  15. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...bases without creating a double-strand break. This method displays higher efficiency than HDR-mediated editing...the overall effect is an A->G change. Since this method targets RNA rather than DNA, it does not create...targeting : Cas13 enzymes target RNA rather than DNA, sometimes requiring a protospacer flanking sequence (PFS...biotin-streptavidin pulldown (CAPTURE.) Tag : Multiple methods make it easier to tag endogenous loci with epitope...

  16. Mammalian RNAi Tools

    Type
    Collection
    ...viral vectors. Lentiviral vectors are a preferred method for long-term gene silencing. Once the viral vector..., delivery, and assessment of gene knockdown . Methods in Molecular Biology, 629 , 141–158. PubMed (Link...conditional systems for RNA interference . Nature Methods, 3 (9), 682–688. PubMed (Link opens in a new window...

  17. Microbiology Resources

    Type
    Collection
    ...Archaea Species Haloferax sp. Methanococcus maripaludis Methanothermobacter thermautotrophicus Sulfolobus...is not always straightforward. Read our CRISPR Methods for Bacterial Genome Engineering blog post to see...

  18. AAV Packaged on Request

    Type
    Collection
    ...serves the needs of many researchers, scientists sometimes require preps beyond our current in-stock capabilities... contributing your AAV vector experience, from methods to troubleshooting insights, you make research ...goes unshared, bridging the gap between published methods and real-world troubleshooting. Eligible Plasmids...

  19. Validated gRNA Sequences

    Type
    Collection
    ...25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC 61514 nick S. pyogenes 25569111 Hanna Mettl14 M. musculus...BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš Non-targeting H. .... sapiens GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...

  20. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...mutant adeno-associated viral vector. Hum Gene Ther Methods . Feb;25(1):72-82. PMID: 24191859 Ye, et al. 2015...Engineered AAV Capsids Improve Transduction and Volumetric Spread in the CNS. Mol Ther Nucleic Acids . Sep...by novel capsid-modified AAV6 vectors. Mol Ther Methods Clin Dev . Apr 13;3:16026. PMID: 27308302 AAV44.9...
Showing: 21 - 40 of 84 results