We narrowed to 62 results for: STO
-
TypeCollection...References Rapid 'open-source' engineering of customized zinc-finger nucleases for highly efficient gene... (OPEN): an 'open-source' protocol for making customized zinc-finger arrays. Maeder ML et al. Nat Protoc...19798082 . Targeted mutagenesis in zebrafish using customized zinc-finger nucleases. Foley JE et al. Nat Protoc...
-
Neurodegeneration Research Collection
TypeCollection...most neurodegenerative diseases are only partly understood, and there are no effective therapies to prevent...symptom onset. Disease mechanisms are still poorly understood but several genes and mapped loci seem to be ...95%) of ALS are sporadic, having no prior family history. A small percentage (5-10%) are familial ALS cases... -
Rett Syndrome
TypeCollection...almost 46% of all Rett syndrome cases. Research Milestones 1992 - MECP2 is discovered by Adrian Bird's lab...regardless of age or symptom severity, suggesting that restoring MECP2 expression in humans could be curative. ...therapeutic strategies to treat Rett syndrome and restore functional MECP2 in cells. Search (Link opens in... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...protein purification. Just remember to remove the stop codon for C-terminal tags and omit the start codon... pDest vector that adds an N-terminal myristoylation signal GST Protein purification...targeting TALEN kits - Construct a custom TALEN array for genomic engineering Luciferase ... -
Plasmids for Stem Cell Research
TypeCollection...reprogramming factors Fluorescent tagged episomals for stoichiometric induced pluripotent stem cell reprogramming...from four separate plasmids Defining molecular cornerstones during fibroblast to iPS cell reprogramming ...Direct Induction of the Three Pre-implantation Blastocyst Cell Types from Fibroblasts. Cell Stem Cell. ... -
Antibodies
TypeCollection...summarize antibody production and storage techniques, and explain common applications. View...some of our other resources to help you choose, store, or use your antibody. Antibody Blog Posts Recipient... -
Structural Genomics Consortium Plasmids
TypeCollection...Many SGC plasmids from the Toronto, Oxford and Stockholm sites have been deposited at Addgene and are available...collection by All Plasmids SGC Toronto SGC Oxford SGC Stockholm Bacterial Expression Plasmids (empty backbones... -
All Antibodies
TypeCollection...species. We currently assess western blot, immunohistochemistry, and immunocytochemistry. Addgene will continue...some of our other resources to help you choose, store, or use your antibody. Antibody Guide Antibody Protocols... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection... (OPEN): an 'open-source' protocol for making customized zinc-finger arrays. Maeder ML, Thibodeau-Beganny... -
AAVED
TypeCollection...meeting. The goal of this year’s workshop is to brainstorm practical strategies for using combinations of...the lab (e.g., controls to perform, recommended histology conditions, minimum/maximum incubation time after... -
Adeno-associated virus (AAV) Plasmids
TypeCollection...originally discovered as contaminants of adenovirus stocks. One major advantage of using AAV for research ... and learn about our options for hundreds of in-stock preps that are ready to ship right away, as well... -
Worm Expression Resources
TypeCollection... described in Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis... - The CGC collects, maintains, and distributes stocks of C. elegans. Silencing Genomes - Cold Spring ... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...109121 HIST1H2BJ-mEGFP AICSDP-52 mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP ... -
AAV Packaged on Request
TypeCollection...lowest biosafety protection levels. We offer 963 in-stock viral vector preps, delivering high quality and ...scientists sometimes require preps beyond our current in-stock capabilities. To meet that need, our Packaged on... -
CRISPR Plasmids - Mammalian Expression
TypeCollection... Available modifications include histone acetylation by p300, histone demethylation by LSD1, cytosine ... -
Ras Pathway
TypeCollection...oncogene homolog Muscle RAS oncogene homolog Neuroblastoma RAS viral (v-ras) oncogene homolog RASA RASA1...RASSF10 Ras association domain family member RB1 Retinoblastoma 1 RCE1 Ras converting CAAX endopeptidase 1 ... -
CRISPR Guide
TypeCollection...insertions, or frameshift mutations leading to premature stop codons within the open reading frame (ORF) of the... cytosines in a gene’s promoter or by inducing histone acetylation or demethylation. The most common modifiers... green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence microscopy...gene by shifting the ORF and/or creating premature stop codons NHEJ N on- H omologous E nd J oining; A DNA... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Green Yellow Orange Red Far-Red Near-Infrared Long Stokes Shift Photoactivatable Photoconvertible Photoswitchable...HisB-iRFP720 - Bacterial Expression Jump to Top Long Stokes Shift Protein Excitation (nm) Emission (nm) Brightness... -
Genetic Code Expansion
TypeCollection...challenging. In E.coli , the rarest codon is the amber stop codon (UAG) and thus this codon is often used. The...sites changes to UAG, RF1 function removed, MutS restored so decreased mutation rate George Church 68306... -
Validated gRNA Sequences
TypeCollection...Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586 cut S. pyogenes 26018130 Xue Lox-STOP-Lox synthetic...