We narrowed to 51 results for: cas9 genes
-
TypeCollection...Mammalian ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid Gene/Insert Promoter PI ...catalytically inactive Cas9 (dCas9) is fused to FokI nuclease. When FokI dimerizes, it generates a double-strand...PI Publication Yeast ID Plasmid Gene/Insert Promoter PI Publication Do you have suggestions for other plasmids... CRISPR dCas9-FokI CRISPR: dCas9-FokI...with dCas9 fused to FokI for creating double-strand breaks (DSBs). CRISPR...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...
-
CRISPR Plasmids - Mammalian Expression
TypeCollection...Plasmid Gene/Insert Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be...(HDR). ID Plasmid Gene/Insert Promoter Selectable Marker Publication Prime Edit Cas9 H840A nickase fused... to immunoprecipitate FLAG-tagged Cas9. In the CAPTURE system, Cas9 is tagged with a biotin acceptor site...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Visualize A catalytically inactive Cas9 (dCas9...dead dCas9, or dCas9 fused to a transcriptional repressor peptide like KRAB, can knock down gene expression...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to...transcription of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or ... -
Brzezinski Lab CRISPR Collection
TypeCollection...lab utilizes a CRISPR/Cas9 based approach to knockout, repress, and activate gene targets. To accomplish...fusion for gene activation CRISPR/Cas9 Plasmid Variants Figure 1: Schematic of the CRISPR Collection. Plasmids... plasmids dCas9-KRAB-MeCP2 fusion for gene and non-coding enhancer sequence repression dCas9-VPR fusion...CRISPR Collection The Brzezinski lab investigates gene regulation in the context of the developing mouse...taken advantage of the Zhang lab all-in-one (guide/Cas9/reporter) pX458 plasmid family. They have made several...pX458 plasmid to expand its usefulness for the lab's gene regulation and developmental studies. Key plasmid...fate specification, yet differs from deleting both genes . Development. doi: 10.1242/dev.190272. PMID: 32541005... -
CRISPR Plasmids - Plants
TypeCollection...-expressed Cas9 Cas9 System Selection PI 46968 pICSL01009::AtU6p aU6 BsaI none S. pyogenes Kamoun 52255...HDR). ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9 H840A nickase fused...dead dCas9, or dCas9 fused to a transcriptional repressor peptide like KRAB, can knock down gene expression...ID Plasmid Gene/Insert Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to...transcription of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or ... plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter Selectable... -
AAV Molecular Tools
TypeCollection...Engineering Tools These AAV encode Cas9 nuclease used in the CRISPR-Cas9 system for targeted genome editing...AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA CMV-driven, constitutive Expression of human codon-optimized Cas9 from Staphylococcus...Long Overexpression Tools These AAV encode various genes for overexpression. ID Name Expression System Activity...Ready-to-use AAV available from Addgene's viral service encoding tet-off transactivators and tools for...Staphylococcus aureus (SaCas9). 6 Zhang Labeling Tools These AAV encode tools that can be used for cell... -
CRISPR Plasmids - Cascade-Cas3
TypeCollection...Mammalian ID Plasmid Gene/Insert Promoter PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication... genomic deletions. Compared to deletions generated by Cas9, large deletions created using Cas3 have fewer...underutilized compared to their Class 2 counterparts like Cas9. This is attributed in part to the difficulties ... Publication Plant ID Plasmid Gene/Insert Promoter PI Publication Last reviewed on: January 30, 2025 Do...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!... -
CRISPR Plasmids - gRNAs
TypeCollection...off-target effect. Which species or variant of Cas9 ( S. pyogenes , S. aureus etc.) was this gRNA sequence ...species or PAM binding variant of Cas9. For instance, wild-type SpCas9 must be used with targets that are... lists gRNA plasmids designed to target various genes or genomic regions. It is highly recommended that...the experimental use of these plasmids. ID Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions...gRNA expression vectors available from Addgene. CRISPR...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
Validated gRNA Sequences
TypeCollection...Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor... your target. Which species or variant of Cas9 ( S. pyogenes, S. aureus etc.) was this gRNA sequence designed...single species or PAM binding variant of Cas9 (e.g. Wild-type SpCas9 must be used with targets that are upstream...described on Addgene's CRISPR Plasmids and Resources page have been used to indicate the Cas9 application...cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG 65630 cut S. pyogenes 26044730...59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799... -
CRISPR Plasmids - Purify Genomic Loci
TypeCollection... ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter... for enChIP, as well as an anti-Cas9 antibody. Biotin tagging of dCas9 can be achieved by fusing a biotin...Selectable Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...inactive dCas9 is used to purify genomic DNA bound by the gRNA. An epitope tag(s) can be fused to dCas9 or ...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...biotin acceptor site to dCas9 and co-expressing BirA biotin ligase, as seen in the CAPTURE system. The ... -
CRISPR Plasmids - RNA Targeting
TypeCollection...ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacterial ID Plasmid Gene/Insert PI Publication...crRNA. This activity provides a stark contrast to Cas9 and Cpf1, which require that each DNA target have... Publication Plant ID Plasmid Gene/Insert PI Publication Do you have suggestions for other plasmids that...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!... -
CRISPR Plasmids for Genomic Visualization
TypeCollection... inactive Cas9 (dCas9) fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable... throughout the chromosome. Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!... -
CRISPR Plasmids - Parasites
TypeCollection...developments with CRISPR-Cas9 gene editing have propelled both reverse and forward genetics of these parasites...parasites. Moreover, CRISPR-dCas9 gene regulation has also been established for some of these parasites. Together... these tools have enabled precise genetic analyses to pinpoint genes linked to parasite virulence, transmission...at a much lower efficiency than NHEJ. ID Plasmid Gene/Insert Selectable Marker PI Publication Libraries...10 guides against 8,158 predicted protein-coding genes. Do you have suggestions for other plasmids that...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
Neurodegeneration Research Collection
TypeCollection...type or mutant ORFs, gene fragments, and gRNAs for genes linked to neurodegenerative disorders. Find plasmids...within the huntingtin (HTT) gene. An individual with the mutated HTT gene will have huntingtin proteins...association between a gene and late-onset AD. It is more likely a combination of gene variation and lifestyle... oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent rodent species... are associated with known genetic mutations in one of the following genes: SOD1, C9ORF72, TARDBP, FUS...three different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals...these additional genes may play in Alzheimer's disease. Research Tools Neurodegeneration Plasmid Collection... -
Botman-Teusink Yeast FP Collection
TypeCollection...marker. ID Plasmid Gene/Insert Selectable Marker Publication Additional Resources Addgene Kits MoClo-YTK ...Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit Other Addgene Plasmids Bas Teusink Lab Materials Kurt...constitutive overexpression of FPs and tagging of genes of interest with FPs in yeast. Characterization ...Bydder, S. F., Zhou, Y., Nielsen, L. K. (2013). Dual gene expression cassette vectors with antibiotic selection... -
Distribution to Industry
TypeCollection...currently available to industry scientists. ID Plasmid Gene/Insert PI Kits Kit name Type PI Description High...Stiewe Use these donor vector libraries for CRISPR/Cas9-mediated saturation genome editing of human TP53...Packaging from Addgene Parkinson's Research from The Michael J Fox Foundation Search Use Addgene's Search to...protection for material providers. Addgene's deposit agreements allow Addgene to distribute plasmids on behalf...can be submitted to Addgene through your user account or by email to mta@addgene.org . After we review ...A portion of Addgene's collection is available to qualified for-profit entities. Addgene reserves the ...Addgene has a growing collection of plasmids that are available to industry. Learn more about the available... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection... vector for gene expression pINDUCER21 (ORF-EG) - Inducible lentiviral gene expression ...destination vector for gene expression Lentiviral backbones made by Addgene Addgene has an extensive collection...host cell and are designed for a user to insert a gene of interest. They may contain tags or fusion proteins...These vectors allow you to test the function of your gene of interest in a controlled environment under various...we will assume that you want to express a gene; however, we have included a function section for if you...If you want to drive expression of your favorite gene, you will need a plasmid with a promoter that...mTagBFP2 tag pNIC-GST-TEV-GG - Cloning of target gene with N-terminal GST tag and TEV cleavage Transient... -
CRISPR Pooled gRNA Libraries
TypeCollection...ID Library Type Species PI Lentiviral Generation gRNAs per gene Total gRNAs Adamson DNA Repair CRISPRi...each containing multiple gRNAs for each target gene. In a CRISPR screening experiment, target cells ...require the use of lentivirus to deliver the gRNA/Cas9 to target cells. Therefore, you must be equipped...are used to knockout, activate or repress target genes. Number of gRNAs - A given CRISPR library may target...target the entire genome or a specific class of genes (subpools). Species - the gRNAs within a given CRISPR...86550 Inhibition Human Weissman 3rd 10 Varies CRISPR/Cas9-assisted Removal of Mitochondrial DNA (CARM) Library...Human Yusa 3rd 5 90,709 Human Interferon-Stimulated Gene CRISPR Knockout Library 125753 Knockout Human Emerman... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...excised, and gene expression proceeds. Gene Knockout: Placing the loxP sites on either side of a gene (called...shRNA expression. Gene Switch: These constructs contain two genes of interest, Genes A and B. When Cre... few popular recombinase-dependent gene expression strategies. Gene Expression: A stop codon flanked with...LSL" cassette) placed upstream of a gene of interest will prevent gene expression in the absence of Cre.... loxP"), will permit gene expression until Cre is present, at which time the gene will be disrupted or...Cre is absent, only Gene A is translated correctly. Cre expression excises Gene A and alters the reading...backbone to regulate your gene of interest. Depending on the construct, gene expression may be activated... -
Rett Syndrome
TypeCollection...and aggressive plan to use gene editing, MECP2 reactivation, RNA editing, gene replacement therapy, RNA ...mutations in the MECP2 gene. Please refer to Addgene's CRISPR Guide for a general introduction to CRISPR...diagnostic criteria have disease-causing mutations in the gene methyl-CpG binding protein 2 ( MECP2 ). MECP2 Rett...caused from loss-of-function mutations in the MECP2 gene. Causative mutations for Rett syndrome typically...global transcriptional regulator of thousands of genes and studies have suggested roles in transcriptional...activity dependent de-repression, chromatin remodeling, gene activation, and more. How loss of MECP2 protein ...suggests the major function of MECP2 is to regulate gene expression either locally or globally. The MECP2... -
Tetracycline Inducible Expression
TypeCollection...promoter upstream of your gene of interest. If your gene of interest should be generally active and only turned...Tet-On Systems for Doxycycline-inducible Gene Expression . Curr Gene Ther, 16 (3), 156–167. https://doi.org...Tet-On system for regulated gene expression through viral evolution . Gene Ther, 13 (19), 1382–1390. https...downstream gene via its activation domain than simply removing the repressor. 2nd and 3rd Generation Systems...tet-inducible Cas9-2A-EGFP expression. Based on LentiCRISPR v2 . Adam Karpf 167935 pLenti-tetON-KRAB-dCas9-DHFR-EF1a-TagRFP...Learn about tetracycline-regulated gene expression and find plasmids for your experiments using tet- ...repressible promoters are powerful tools to control gene expression and study biological targets. The tetracycline...