Skip to main content
Addgene

We narrowed to 28 results for: aav gfp cre

Showing: 21 - 28 of 28 results
  1. Plan Your Experiment

    Type
    Collection
    ...genome-wide screens using CRISPR AAV transduction CRISPR elements are inserted into an AAV transfer vector...vector and used to generate AAV particles (for details, see our AAV Guide ) ∼4.5 kb packaging limit (only...typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells, or selection...transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich positive.../or gRNA Infects dividing and non-dividing cells AAV is the least toxic method for in vivo viral delivery...mutant allele of a gene ( point mutant )? Increase or decrease expression of a target gene? Once you have...High-fidelity Cas enzymes increase specificity. Dual-nickase approach increases specificity but is less ...
  2. Neurodegeneration Research Collection

    Type
    Collection
    ... Nat Biotechnol. 2023 May 22. See More AAV Viral Preps Find AAV viral preps for systemic delivery of viral...Noteworthy: AAV.rTH.PI.Cre.SV40 ready-to-use viral prep useful for dopamine research. CBA-driven, Cre-dependent...research. Disease Info Plasmid Collection CRISPR Tools AAV Viral Preps iPSC Differentiation Factors Antibodies...Oct 18. Target neural oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent...Cre-dependent expression of diphtheria toxin receptor (DTR)–GFP fusion protein. Azim et al. Nature. 2014 Apr 17. ...blood brain barrier integrity, and using CRISPR screens to understand more globally how neurons function...antibodies and scFvs for neuroscience research created with high-volume hybridoma sequencing on the NeuroMabSeq...
  3. Tetracycline Inducible Expression

    Type
    Collection
    ...hairpin and GFP under pTREtight promoter None Either Elledge 35625 pAAV-Ptet-RFP-shR-rtTA AAV; shRNA cloning...option rtTA On Kowarz 16623 pBI-GFP Expression of your gene of interest & GFP from a bidirectional tet-responsive...Either Lung 11662 pPRIME-TET-GFP-FF3 Lentiviral, miRNA expression (PRIME) system for application in knockdown...Safe Harbor Locus. Tet-On 3G On Doyon 58245 pGLTR-X-GFP Single vector lentiviral Gateway RNAi system for ...generation; contains expression cassette for TetR-P2A-GFP; see article for additional constructs TetR On Geley...inducible promoter at its 3' end, which controls GFP expression tTA Off Verma 26803 pEnt L1L3 EF1a-tTA...16542 pBI-MCS-EGFP Expression of your gene of interest (MCS with a β-globin poly A) & EGFP from a bidirectional...
  4. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...
  5. CRISPR Plasmids - Tagging

    Type
    Collection
    ...include Cre and FLP expression vectors, a general cloning plasmid, and a prebuilt Unc-32::GFP targeting...provide PCR templates for amplification of the tag (eg GFP, Flag, YFP, etc) and selection markers. Two independent..._CEBPA_1 PX458_CEBPA_2 CREB1 Human FLAG pFETCh_CREB1 PX458_CREB_1 PX458_CREB_2 TGIF2 Human FLAG pFETCh_TGIF2...targeting the AAVS1 locus. Doyon Tagging Plasmid: 3xFLAG-2xSTREP Construct for integrating at the AAVS1 "safe ... lines were created using CRISPR and the donor plasmids containing homology arms and EGFP are available...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...cloned directly into this vector and targeted to the AAVS1 genomic safe harbor locus using untagged SpCas9 ...
  6. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens...
  7. CRISPR Guide

    Type
    Collection
    .... Mammalian CRISPR libraries have also been created in AAV backbones for in vivo experiments and in a ...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence...efficiently packaged into adeno-associated viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9 ...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert...capabilities but are small enough to be packaged in AAV particles. Cas13 fusions have also been used in in... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes...
  8. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36 mEGFP NA Cytoplasm 114405 ATP2A2-mEGFP AICSDP-41 mEGFP SERCA2 Sarcoplasmic...Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin...87422 LMNB1-mEGFP AICSDP-10 mEGFP Lamin B1 Nuclear envelope 87423 TOMM20-mEGFP AICSDP-8 mEGFP Tom20 Mitochondria...Mitochondria 87424 DSP-mEGFP AICSDP-9 mEGFP Desmoplakin Desmosomes 87425 ACTB-mEGFP AICSDP-15 mEGFP Beta-actin Actin... SEC61B-mEGFP AICSDP-7 mEGFP Sec61 beta Endoplasmic reticulum 87427 FBL-mEGFP AICSDP-13 mEGFP Fibrillarin...AICSDP-23 mEGFP Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP NA Cytoplasm...101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...
Showing: 21 - 28 of 28 results