Skip to main content

We narrowed to 72 results for: CRISPR

Showing: 41 - 60 of 72 results
  1. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts CRISPR requires... CRISPR Empty gRNA Vectors CRISPR Plasmids: Empty gRNA Expression Vectors Browse CRISPR Plasmids...plasmids and therefore are not limited to a single CRISPR function. Alternatively, gRNA-only plasmids can...gRNA sequence, such as BsbI or BsaI Cas9 (or other CRISPR) system that the vector was designed to be used...to be used with. crRNAs used with Cpf1 or other CRISPR systems are also listed here and denoted as such...enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity...Plasmids Expression System Description PI Multiplex CRISPR/Cas9 Assembly System Kit Mammalian A system for...
  2. Plasmid Collections

    Type
    Collection
    ...plasmids, kits, and pooled libraries. Find tools for CRISPR, fluorescent proteins, optogenetics, biosensors... Genome Engineering Genome Engineering Overview CRISPR Cre-lox TALENs Zinc Fingers Luminescence Fluorescent...pooled libraries. Pooled Library Types cDNA shRNA CRISPR gRNAs Depositor Collections A modular set of plasmids...view all collections. Depositor Collection Types CRISPR Fluorescent Proteins Protein Expression Synthetic...
  3. Bacterial Expression Systems

    Type
    Collection
    ...with Addgene's CRISPR Guide . Browse CRISPR plasmids available at Addgene through our CRISPR Plasmids and...tools like CRISPR-Cas9 are not only valuable but often essential. Find a collection of CRISPR plasmids ...Bacterial CRISPR Plasmids page . Additional Addgene Genome Engineering Resources Learn more about CRISPR with...zinc finger proteins. Addgene Blog CRISPR Methods for Bacteria CRISPR-based Genome Editing Systems For ...Empty Backbones Collection Molecular Biology Guide CRISPR Guide Bacteria are commonly used to create, store...coli INTEGRATE: Bacterial Genome Engineering Using CRISPR-Transposons Return to top Content last reviewed...ratio) Escherichia coli Christopher Voigt 65008 pCRISPReporter-mCherry Promoter activity Fluorescence (mCherry...
  4. Rett Syndrome

    Type
    Collection
    ...Addgene's CRISPR Guide for a general introduction to CRISPR technology or the mammalian CRISPR resources...'s Plasmids for Stem Cell Research page. CRISPR Tools CRISPR technology is a promising therapeutic approach...examples of additional CRISPR resources can be found below: Base Editing RNA Editing CRISPR-based DNA methylation...Resource Center MECP2 Animal Models Human Cell Lines CRISPR Tools Plasmids Resources The (Link opens in a new...
  5. Neurodegeneration Research Collection

    Type
    Collection
    ...Dhekne et al. Elife. 2023 Oct 24. See More CRISPR Tools Find CRISPR pooled libraries available from Addgene...neurodegeneration research. Disease Info Plasmid Collection CRISPR Tools AAV Viral Preps iPSC Differentiation Factors...about the blood brain barrier integrity, and using CRISPR screens to understand more globally how neurons.... Target neural oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent...plasmid pooled libraries . New and Noteworthy: Use a CRISPRi system to target alpha-synuclein. Sastre et al....
  6. Distribution to Industry

    Type
    Collection
    ...Mutation Libraries CRISPR Thorsten Stiewe Use these donor vector libraries for CRISPR/Cas9-mediated saturation...Fusions from Promega COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent Proteins from the Michael Davidson...
  7. Validated gRNA Sequences

    Type
    Collection
    ...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens...
  8. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Tumor Suppressor Gene CRISPR Knockout Library CRISPR Sidi Chen Use this AAV CRISPR knockout library expressing...Plasmid Collection Monosynaptic Neuronal Tracing CRISPR Plasmids and Resources Content last reviewed on...
  9. Plasmids for Stem Cell Research

    Type
    Collection
    ...Retinal Ganglion Cells AAV/CRISPR Mouse Glia-to-Neuron Conversion by CRISPR-CasRx Alleviates Symptoms ...mitosis. Nat Commun. 2016 Mar 7;7:10869. Hu CRISPRa Human CRISPR activator system for reprogramming human...enogenous genes Human pluripotent reprogramming with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski... Brennand iPSCs Cortical or Lower Motor Neurons CRISPR/TALEN Human Transcription Factor-Mediated Differentiation...
  10. Antibody Plasmid Collection

    Type
    Collection
    ...BMC Biotechnol. 2006 Dec 7;6:46. John McCafferty CRISPR system to rapidly engineer the constant immunoglobulin...diversification of hybridoma-produced antibodies by CRISPR/HDR genomic engineering. Sci Adv. 2019 Aug 28;5...
  11. Depositor Collections

    Type
    Collection
    ...Browse depositor collections of antibody, CRISPR, disease research, visualization, protein expression...
  12. Lentivirus Plasmids

    Type
    Collection
    ...lentiviral plasmids to express your CRISPR gRNA? Please see our CRISPR Empty gRNA plasmids table and search...
  13. AAV Viral Preps

    Type
    Collection
    ...Transactivators, Affinity Purification, Cell Ablation, CRISPR Monosynaptic Neuronal Tracing Rabies Virus-Based...
  14. TALEN Engineering

    Type
    Collection
    ...Keith Joung Lab plasmids Daniel Voytas Lab plasmids CRISPR plasmids The Joung Lab has developed three platforms...
  15. COVID-19 Resources

    Type
    Collection
    ...may be helpful for COVID-19 research, including: CRISPR tools, like Cas12a and Cas13a plasmids, to reliably... of the 2019 novel coronavirus SARS-CoV-2 using CRISPR diagnostics: DETECTR (Link opens in a new window...
Showing: 41 - 60 of 72 results