We narrowed to 83 results for: SPR
-
TypeCollection...Packaging Service page . Pooled CRISPR Libraries for Screening Use pooled CRISPR libraries to screen for genes...gRNA pooled library in lentiCRISPRv2 Human sgRNA library in backbone lentiCRISPRv2 targeting 19,114 genes...92379 Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A Human CRISPRa sgRNA activation...libraries 92385 Human CRISPR inhibition library Dolcetto in XPR_050 (VP64) Set A Human CRISPR inhibition library...Root 92386 Human CRISPR inhibition library Dolcetto in XPR_050 (VP64) Set B Human CRISPR inhibition library...genes. For more information on CRISPR plasmids and function, see our CRISPR plasmids resource page . Cas9...Service Lentivirus Browse In-Stock Lentivirus Pooled CRISPR Libraries Cas9 Pooled Barcoding Libraries Control...
-
Ras Pathway
TypeCollection...factor SPRED SPRED1 SPRED2 SPRED3 Sprouty related, EVH1 domain containing SPRY SPRY1 SPRY2 SPRY3 SPRY4 ...SPRY4 Sprouty RTK signaling antagonist STK STK3 STK4 Serine/threonine kinase STK11 Serine/threonine kinase... -
Bacterial Expression Systems
TypeCollection...with Addgene's CRISPR Guide . Browse CRISPR plasmids available at Addgene through our CRISPR Plasmids and...tools like CRISPR-Cas9 are not only valuable but often essential. Find a collection of CRISPR plasmids ...Bacterial CRISPR Plasmids page . Additional Addgene Genome Engineering Resources Learn more about CRISPR with...zinc finger proteins. Addgene Blog CRISPR Methods for Bacteria CRISPR-based Genome Editing Systems For ...Empty Backbones Collection Molecular Biology Guide CRISPR Guide Bacteria are commonly used to create, store...ratio) Escherichia coli Christopher Voigt 65008 pCRISPReporter-mCherry Promoter activity Fluorescence (mCherry...coli INTEGRATE: Bacterial Genome Engineering Using CRISPR-Transposons Return to top Content last reviewed... -
Validated gRNA Sequences
TypeCollection...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens... -
Trimmer Lab NeuroMab Collection
TypeCollection...Anti-CASPR/Neurexin IV [K65A/2R] CASPR/Neurexin IV Mouse IgG2a 206606 Anti-CASPR2 [K67/11R] CASPR2 Human...177445 Anti-CASPR/Neurexin IV [K65/35R] CASPR/Neurexin IV Rat Mouse IgG2a 177446 Anti-CASPR2 [K67/25R] ...219448 Anti-CASPR/Neurexin IV [K65A/30R] CASPR/Neurexin IV Rat Mouse IgG2a 219449 Anti-CASPR/Neurexin IV...SAP97 Rat Mouse IgG2a 128625 Anti-CASPR/Neurexin IV [K66/38R] CASPR/Neurexin IV Rat Mouse IgG2a 128626...VAPA Rat Mouse IgG2a 199403 Anti-CASPR/Neurexin IV [K65/35R-2b] CASPR/Neurexin IV Rat Mouse IgG2b 199404...external) Human Mouse IgG1 206683 Anti-CASPR/Neurexin IV [K65/35R-1] CASPR/Neurexin IV Rat Mouse IgG1 206684...K28/77R] PSD-95 Human Mouse IgG2a 220381 Caspr [K65/31R] Caspr Rat Mouse IgG2a 220382 KChIP3 K+ channel... -
COVID-19 Resources
TypeCollection...Lab Cas12a plasmids Addgene's full CRISPR guide and summary of CRISPR pooled libraries . FlipGFP-based ...coronavirus - Enabling coronavirus detection using CRISPR-Cas13: Open-access SHERLOCK research protocols ...develop the method termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has... of the 2019 novel coronavirus SARS-CoV-2 using CRISPR diagnostics: SARS-CoV-2 DETECTR (Link opens in ...now available from Ray Owens' lab. Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and...181(4):865-876.e12. (Link opens in a new window) CRISPR tools and reporters now available from Stanley ...Collection Science Journals Coronavirus Collection Springer Nature SARS-CoV-2 and COVID-19 Articles Wiley ... -
Rett Syndrome
TypeCollection...Addgene's CRISPR Guide for a general introduction to CRISPR technology or the mammalian CRISPR resources...'s Plasmids for Stem Cell Research page. CRISPR Tools CRISPR technology is a promising therapeutic approach...examples of additional CRISPR resources can be found below: Base Editing RNA Editing CRISPR-based DNA methylation...Resource Center MECP2 Animal Models Human Cell Lines CRISPR Tools Plasmids Resources The (Link opens in a new... -
AAV for Neuronal Tracing
TypeCollection...but new virus cannot spread to any neighboring cells. To enable monosynaptic spread of this deletion-mutant...the virus can spread from this cell to synaptically connected cells (meaning, it can spread to cells that...infected cells, but is required for transynnaptic spread (Wickersham et al., 2007a, Wickersham et al., 2007b...through complementation, G-deleted rabies virus can spread to monosynaptically connected cells. To further... -
Neurodegeneration Research Collection
TypeCollection...Dhekne et al. Elife. 2023 Oct 24. See More CRISPR Tools Find CRISPR pooled libraries available from Addgene...neurodegeneration research. Disease Info Plasmid Collection CRISPR Tools AAV Viral Preps iPSC Differentiation Factors...about the blood brain barrier integrity, and using CRISPR screens to understand more globally how neurons...plasmid pooled libraries . New and Noteworthy: Use a CRISPRi system to target alpha-synuclein. Sastre et al..... Target neural oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent... -
Resolute Plasmid Collection
TypeCollection...Plasmid Gene/Insert Industry PI Pooled Libraries CRISPR and overexpression pooled libraries are useful ...Human SLC Activation Library 132561 Superti-Furga CRISPR activation library targeting human SLC proteins...Human SLC Knockout Library 132552 Superti-Furga CRISPR knockout library targeting human SLC proteins. ...Mouse SLC Knockout Library 141436 Superti-Furga CRISPR knockout library targeting mouse SLC proteins. ...Knockout Libraries 213695 221409 221410 Superti-Furga CRISPR knockout library targeting human transmembrane ... -
Plasmids for Stem Cell Research
TypeCollection...mitosis. Nat Commun. 2016 Mar 7;7:10869. Hu CRISPRa Human CRISPR activator system for reprogramming human...Retinal Ganglion Cells AAV/CRISPR Mouse Glia-to-Neuron Conversion by CRISPR-CasRx Alleviates Symptoms ...enogenous genes Human pluripotent reprogramming with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski... Brennand iPSCs Cortical or Lower Motor Neurons CRISPR/TALEN Human Transcription Factor-Mediated Differentiation... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...Representative Empty Backbones CRISPR Genome modification lentiCRISPR v2 - 3rd gen lentiviral vector ... Lentiviral shRNA expression lentiCRISPRv2 hygro - Variant of lentiCRISPR v2 that confers hygromycin resistance...for RNA-guided genome editing in plants Visit our CRISPR Plasmids and Resources collection, and browse our... -
Plasmid Collections
TypeCollection...plasmids, kits, and pooled libraries. Find tools for CRISPR, fluorescent proteins, optogenetics, biosensors... Genome Engineering Genome Engineering Overview CRISPR Cre-lox TALENs Zinc Fingers Luminescence Fluorescent...pooled libraries. Pooled Library Types cDNA shRNA CRISPR gRNAs Depositor Collections A modular set of plasmids...view all collections. Depositor Collection Types CRISPR Fluorescent Proteins Protein Expression Synthetic... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...subretinal administration and enhanced transduction and spread following injection in the brain. The AAV2(4pMut...displays highly efficient transduction and lateral spread in the retina following subretinal injection. It...serotype has increased transduction and lateral spread in the retina following subretinal injection as...AAV Capsids Improve Transduction and Volumetric Spread in the CNS. Mol Ther Nucleic Acids . Sep 15;8:184... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...Tumor Suppressor Gene CRISPR Knockout Library CRISPR Sidi Chen Use this AAV CRISPR knockout library expressing...Plasmid Collection Monosynaptic Neuronal Tracing CRISPR Plasmids and Resources Site-specific recombinase... -
Distribution to Industry
TypeCollection...Mutation Libraries CRISPR Thorsten Stiewe Use these donor vector libraries for CRISPR/Cas9-mediated saturation...Fusions from Promega COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent Proteins from the Michael Davidson... -
Tetracycline Inducible Expression
TypeCollection...expression of KRAB-dCas9-DHFR for CRISPRi. See Plasmid #167937 for CRISPRa Emma Rawlins 72835 pMK243 (Tet-OsTIR1...-inducible Cas9-2A-EGFP expression. Based on LentiCRISPR v2 . Adam Karpf 167935 pLenti-tetON-KRAB-dCas9... -
iPSC Neurodegenerative Disease Initiative Plasmid Collection
TypeCollection...Initiative (iNDI) Collection You May Also Like... CRISPR Guide CRISPR Protein Tagging Plasmids for Stem Cell Research... -
Antibody Plasmid Collection
TypeCollection...BMC Biotechnol. 2006 Dec 7;6:46. John McCafferty CRISPR system to rapidly engineer the constant immunoglobulin...diversification of hybridoma-produced antibodies by CRISPR/HDR genomic engineering. Sci Adv. 2019 Aug 28;5... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection... Plasmid Collection You May Also Like... CRISPR Guide CRISPR Protein Tagging Fluorescent Protein Guide...