Skip to main content
Addgene

We narrowed to 71 results for: crispr

Showing: 41 - 60 of 71 results
  1. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...Collections Brzezinski Lab CRISPR Collection Brzezinski Lab CRISPR Collection The Brzezinski lab investigates...for gene activation CRISPR/Cas9 Plasmid Variants Figure 1: Schematic of the CRISPR Collection. Plasmids...Find CRISPR plasmids to study the regulatory networks involved in retinal development. Depositor...involved in retinal development the lab utilizes a CRISPR/Cas9 based approach to knockout, repress, and activate...
  2. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ... CRISPR Prime Edit CRISPR Plasmids: Prime Edit Browse CRISPR Plasmids By Function ...Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts Prime... . Browse, sort, or search the tables below for CRISPR prime editing plasmids. Plasmids are available ...
  3. Resolute Plasmid Collection

    Type
    Collection
    ...Plasmid Gene/Insert Industry PI Pooled Libraries CRISPR and overexpression pooled libraries are useful ...Human SLC Activation Library 132561 Superti-Furga CRISPR activation library targeting human SLC proteins...Human SLC Knockout Library 132552 Superti-Furga CRISPR knockout library targeting human SLC proteins. ...Mouse SLC Knockout Library 141436 Superti-Furga CRISPR knockout library targeting mouse SLC proteins. ...Knockout Libraries 213695 221409 221410 Superti-Furga CRISPR knockout library targeting human transmembrane ...
  4. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts CRISPR requires... CRISPR Empty gRNA Vectors CRISPR Plasmids: Empty gRNA Expression Vectors Browse CRISPR Plasmids...plasmids and therefore are not limited to a single CRISPR function. Alternatively, gRNA-only plasmids can...gRNA sequence, such as BsbI or BsaI Cas9 (or other CRISPR) system that the vector was designed to be used...to be used with. crRNAs used with Cpf1 or other CRISPR systems are also listed here and denoted as such...enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity...Plasmids Expression System Description PI Multiplex CRISPR/Cas9 Assembly System Kit Mammalian A system for...
  5. Plasmid Collections

    Type
    Collection
    ...plasmids, kits, and pooled libraries. Find tools for CRISPR, fluorescent proteins, optogenetics, biosensors... Genome Engineering Genome Engineering Overview CRISPR Cre-lox TALENs Zinc Fingers Luminescence Fluorescent...pooled libraries. Pooled Library Types cDNA shRNA CRISPR gRNAs Depositor Collections A modular set of plasmids...view all collections. Depositor Collection Types CRISPR Fluorescent Proteins Protein Expression Synthetic...
  6. Rett Syndrome

    Type
    Collection
    ...Addgene's CRISPR Guide for a general introduction to CRISPR technology or the mammalian CRISPR resources...'s Plasmids for Stem Cell Research page. CRISPR Tools CRISPR technology is a promising therapeutic approach...examples of additional CRISPR resources can be found below: Base Editing RNA Editing CRISPR-based DNA methylation...Resource Center MECP2 Animal Models Human Cell Lines CRISPR Tools Plasmids Resources The (Link opens in a new...
  7. COVID-19 Resources

    Type
    Collection
    ...Lab Cas12a plasmids Addgene's full CRISPR guide and summary of CRISPR pooled libraries . FlipGFP-based ...coronavirus - Enabling coronavirus detection using CRISPR-Cas13: Open-access SHERLOCK research protocols ...develop the method termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has... of the 2019 novel coronavirus SARS-CoV-2 using CRISPR diagnostics: SARS-CoV-2 DETECTR (Link opens in ...now available from Ray Owens' lab. Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and...181(4):865-876.e12. (Link opens in a new window) CRISPR tools and reporters now available from Stanley ...
  8. Neurodegeneration Research Collection

    Type
    Collection
    ...Dhekne et al. Elife. 2023 Oct 24. See More CRISPR Tools Find CRISPR pooled libraries available from Addgene...neurodegeneration research. Disease Info Plasmid Collection CRISPR Tools AAV Viral Preps iPSC Differentiation Factors...about the blood brain barrier integrity, and using CRISPR screens to understand more globally how neurons.... Target neural oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent...plasmid pooled libraries . New and Noteworthy: Use a CRISPRi system to target alpha-synuclein. Sastre et al....
  9. Distribution to Industry

    Type
    Collection
    ...Mutation Libraries CRISPR Thorsten Stiewe Use these donor vector libraries for CRISPR/Cas9-mediated saturation...Featured Collections COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent Proteins from the Michael Davidson...
  10. Bacterial Expression Systems

    Type
    Collection
    ...list of our bacterial CRISPR plasmids, see here . pwtCas9-bacteria 44250 CRISPR Stanley Qi Anhydrotetracycline... list of our bacterial CRISPR plasmids, see here . pgRNA-bacteria 44251 CRISPR Stanley Qi Expression of...alter bacterial genomes. From recombineering to CRISPR , this collection contains a variety of tools to...research. Plasmid ID Technique PI Purpose pCas9 42876 CRISPR Luciano Marraffini Bacterial expression of Cas9... For a more comprehensive list of our bacterial CRISPR plasmids, see here . pGRG Series Various Plasmids...
  11. Validated gRNA Sequences

    Type
    Collection
    ...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens...
  12. Antibody Plasmid Collection

    Type
    Collection
    ...BMC Biotechnol. 2006 Dec 7;6:46. John McCafferty CRISPR system to rapidly engineer the constant immunoglobulin...diversification of hybridoma-produced antibodies by CRISPR/HDR genomic engineering. Sci Adv. 2019 Aug 28;5...
  13. Plasmids for Stem Cell Research

    Type
    Collection
    ...Retinal Ganglion Cells AAV/CRISPR Mouse Glia-to-Neuron Conversion by CRISPR-CasRx Alleviates Symptoms ...mitosis. Nat Commun. 2016 Mar 7;7:10869. Hu CRISPRa Human CRISPR activator system for reprogramming human...enogenous genes Human pluripotent reprogramming with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski... Brennand iPSCs Cortical or Lower Motor Neurons CRISPR/TALEN Human Transcription Factor-Mediated Differentiation...
  14. Depositor Collections

    Type
    Collection
    ...Browse depositor collections of antibody, CRISPR, disease research, visualization, protein expression...
  15. TALEN Expression Vectors

    Type
    Collection
    ...Keith Joung Lab plasmids Daniel Voytas Lab plasmids CRISPR plasmids This page lists plasmid vectors into which...
Showing: 41 - 60 of 71 results