We narrowed to 60 results for: uros
-
TypeCollection... O'Shea Martin Parniske Antonio Richart Herbert Sauro Claudia Schmidt-Dannert Pamela Silver Lei Stanley... Open access papers on Syn Bio SEVA - Standard European Vector Architecture Open Plant - Plant SynBio ...
-
Microbiology Resources
TypeCollection...External Resources European Saccharomyces Cerevisiae Archive for Functional Analysis (EUROSCARF) (Link opens... -
Ras Pathway
TypeCollection...homolog MTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 NFE2L2 Nuclear factor, erythroid 2 like 2 ...oncogene homolog Muscle RAS oncogene homolog Neuroblastoma RAS viral (v-ras) oncogene homolog RASA RASA1... -
CRISPR References and Information
TypeCollection...construct ; pMA122 (negative selection marker); pGH8 (neuronal co-injection marker); pCFJ104 (body wall muscle... 2 vector system: lentiCas9-Blast and lentiGuide-Puro packaging plasmids: pVSVg , psPAX2 positive control... -
Optogenetics AAV Preps
TypeCollection...Optogenetics is typically used in neuroscience to control electrical potentials in neurons. See our Optogenetics ... -
Retrograde AAV viral preps
TypeCollection...transgene delivery to projection neurons. Specific classes of projection neurons can be targeted by using this... -
CRISPR Pooled gRNA Libraries
TypeCollection...1000000074 (Puromycin) Activation Human Zhang 3rd 3 70,290 SAM v1 - 3 plasmid system 1000000075 (Puromycin) Activation... -
Validated gRNA Sequences
TypeCollection... Zhang Neurog2 H. sapiens GTCTCTATCACTGATAGGGA 64161 activate S. pyogenes 25619936 Sato Neurog2 H. sapiens... -
Michael J Fox Foundation (MJFF) Plasmid Collection
TypeCollection...research. This collection is part of Addgene's Neurodegeneration Research Collection , which includes other... -
Brzezinski Lab CRISPR Collection
TypeCollection...requires a unique enhancer and either Ascl1 or Neurog2 activity . Development, 148(12). doi: 10.1242/dev... -
Adenovirus Plasmids
TypeCollection...production of viruses containing transgene under Neuron-specific enolase (NSE) promoter Bamburg 50959 ShuttleMCP... -
Antibody Production
TypeCollection...protocols see the Addgene Protocols page or the Neuromab Protocols (Link opens in a new window) page. Storage... -
CRISPR Plasmids - Drosophila
TypeCollection...Port 49330 pAc-sgRNA-Cas9 dU6 BspQI Transfection Puromycin yes, cut Ji-Long Liu 45946 pU6-BbsI-chiRNA dU6... -
Chemogenetics AAV Preps
TypeCollection...Use our chemogenetics AAV to chemically induce neuronal activity in specific cell types. See our Chemogenetics... -
mTOR Pathway
TypeCollection...11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1; AKT1 substrate... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...buffers. All buffers are supplemented with 0.001% pluronic F68 or 0.014% Tween 20. Phosphate Buffered Saline... -
TALEN Plasmids and Kits
TypeCollection...EMM71T Golden Gate TALEN 2.0 49401 pBlue-TAL Michal Zurovec pBlue-TAL was designed for use with the Voytas ... -
The Pleiades Promoter Project
TypeCollection...., Arenillas, D. J., Babyak, N., Black, S. F., Bonaguro, R. J., Brauer, E., Candido, T. R., Castellarin... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...Addgene plasmid ID 48139), which include GFP and puromycin as selectable markers, respectively, or constructs... -
CRISPR Guide
TypeCollection...935–949. PMID: 24529477 Nishimasu, H., Shi, X., Ishiguro, S., Gao, L., Hirano, S., Okazaki, S., Noda, T...