We narrowed to 89 results for: BLI;
-
TypeCollection... PubMed lists more than 6,300 CRISPR-related publications, many of which detail work to improve the tool... providing tips from experts in the field, and enabling access to multiple plasmids used for various platform...
-
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...Capsids AAV Packaged on Request AAV Guide Plasmids Publications Enhancer AAV plasmids are plasmids which use...= Substantial non-specific labeling observed Publications Ben-Simon Y, Hooper M, Narayan S, Daigle T, ... -
Genetic Code Expansion
TypeCollection...consider. If you are working off of a previously established protocol, make sure to match the growth medium...changes to UAG, RF1 function removed, improved doubling time. George Church 98564 C321.Ub-UAG-sfGFP all... -
Validated gRNA Sequences
TypeCollection...TATGTTGGTGACTTGCCTCC 58782 cut S. pyogenes 24954249 Yamamoto BLIMP1 H. sapiens CGGATGGGGTAAACGACCCG 59724 cut S. pyogenes...be added to this table from any peer reviewed publication. To add validated gRNA sequences to our datatable... -
Brain Initiative Collection
TypeCollection...development and application of innovative tools enabling large-scale real-time interrogation and monitoring...or when BRAIN Initiative grants are noted in publications associated with Addgene materials. Plasmids ... -
Antibody Guide
TypeCollection...short peptide linkers. Diabodies can be used for assembling protein nanostructures. Figure 2: An antibody...specific to your antibody and assay may already be published. If it is not, you’ll need to validate the antibody... -
Zinc Finger Consortium Reagents
TypeCollection... Lab plasmids The Zinc Finger Consortium was established to promote continued research and development... -
KLF Research Plasmids
TypeCollection...efforts within the KLF community have lead to the establishment of this shared resource on Addgene. If you have... -
NETRF
TypeCollection...encourages its funded scientists to make their published materials and resources available to academic ... -
CRISPR Plasmids - RNA Editing
TypeCollection...systems. Mammalian ID Plasmid Gene/Insert PI Publication Do you have suggestions for other plasmids that... -
Cancer Research Plasmids and Resources
TypeCollection... described in the initial Target Accelerator publications, focused on somatic variants found in lung adenocarcinoma... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that... -
CRISPR Plasmids - Xenopus
TypeCollection... changes. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression... -
CRISPR Plasmids - Zebrafish
TypeCollection... Plasmid Gene/Insert Vector Type Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression... -
Structural Genomics Consortium Plasmids
TypeCollection...proteins of medical relevance, and place them in the public domain without restriction. Many SGC plasmids from... -
Plasmid Collections
TypeCollection...Communities Find a scientific community that has established a common place for deposited plasmids. ASAP Discovery... -
Brzezinski Lab CRISPR Collection
TypeCollection...Plasmids from Collection ID Plasmid Description PI Publications Kaufman, M. L., Goodson, N. B., Park, K. U.,... -
Resolute Plasmid Collection
TypeCollection...development. RESOLUTE (Link opens in a new window) is a public-private partnership of 13 members from industry... -
Mammalian RNAi Tools
TypeCollection...search our full site . ID Plasmid Vector Type PI Publication Additional Resources Addgene Resources pLKO.1... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...expressing mCherry and firefly luciferase. pLentiEGFPdestablized - EFS-EGFPd2PEST-2A-MCS-Hygro - Lentiviral...