...MO, Trono D, Aebischer P. Nat Methods. 2006. Feb;3(2):109-16. PubMed . In vivo RNA interference demonstrates...Lentivectors Toolbox Tyler Jacks Lab Protocols Publications Short hairpin RNA (shRNA): design, delivery,...

... gRNA_DNMT3b A gRNA to DNMT3b Yeast System: Table 2 To function in yeast cells, we designed Cas9 protein...superior for less favorable protospacers and applications requiring particularly tight binding. In these...advisable to use the consensus sequence. See the publication for details. A protocol for synthesizing gRNAs...expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol 48650 PM-SP!TB Bacterial...expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol 48651 PM-NM!TA Bacterial...expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol 48652 PM-NM!TB Bacterial...expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol 48653 PM-ST1!TA Bacterial...

...Golden Gate TALEN Kit and are used in place of pTAL1, 2, 3, or 4. For both plasmids sequence positions 1214...Golden Gate TALEN kit. The GoldyTALEN scaffold is truncated at both the N and C terminus and induces mutation...pC-GoldyTALEN directs expression of TALENs from a truncated CAGs promoter. RCIscript-GoldyTALEN is designed...in vitro mRNA synthesis from the T7 promoter. Truncations were introduced to the N- and C-terminus of the...Golden Gate TALEN 2.0 48705 pTAL7a Boris Greber Application of TALEN technology in hPSCs pTAL7a and pTAL7b...expression in mammalian cells, (iv) an improved, truncated TALE backbone architecture as established by Miller...

...expression tTA Off Verma 26803 pEnt L1L3 EF1a-tTA-2 Contains Gateway L1L3 sites and EF1α promoter driving...Lentiviral, miRNA expression (PRIME) system for application in knockdown of gene expression at a single copy...

...lab collection for more) pLexA and pACT2.2 - Yeast 2-hybrid plasmids Fly UAS, MT Targeted... expression, transgenics and genome modification Species-Specific Expression If you want to drive...His or optimized YFP tags for purification or localization experiments Yeast...for bacterial expression (Gateway) GST Protein Purification pEBG - N-terminal GST for mammalian... packaging and expression. See our dedicated lentiviral plasmid page . Retroviral Easy and ...shRNA expression, transgenics and genome modification Element Details Representative Empty ...

...Calcium sensor Ting 83899 pAAV-mDlx-GCaMP6f-Fishell-2 mDlx GCaMP6f expression under the control of the mDlx...the functional catagories listed below. Narrow down the items available within a category by using the ...experiments can be found on the material pages for viral catalog items. Browse Available Retrograde AAV See our ... Tools Clear Filters ID Name Promoter Activity Category PI Controls 37825 AAV-CAG-GFP CAG GFP Control ...

...extraction solution, runs the protocol, then uses around 2-4ul in each 50ul PCR reaction. The gDNA extracted ... the target site sequence (protospacer+PAM) is located? If there are other PAMs in the region, will they...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Why does...

...dual-transgenic recombinase-expressing mouse lines 2-9 and combinations of transgenic recombinase-expressing...inhibitory opsins , genetically-encoded calcium indicators, and rabies targeting genes. Recombinases Addgene...

...- Bacterial Expression mScarlet-I3 568 592 68 4.2 2 min Monomer pmScarlet-I3_C1 - Mammalian Expression...No. 9, pp. 741-6 Shemiakina et al. : Nature Communications, November 2012, Vol. 3 No. 1204 Wiedenmann ... Vol. 11 No. 5, pp.572-8 Yu et al. : Nature Communications, May 2014 Vol. 15 No. 5, p. 3626 Do you have...