..., Huebener , Rose 83899 pAAV-mDlx-GCaMP6f-Fishell-2 Dlx GCaMP6f none Constitutive 1, 9, rg* Fishell 100833...pAAV.CAG.GCaMP6f.WPRE.SV40 CAG GCaMP6f none Constitutive 1, 2, 9 Kim , GENIE 100837 pAAV.Syn.GCaMP6f.WPRE.SV40 Syn...pAAV-CAG-NIR-GECO2G CAG NIR-GECO2G none Constitutive 1, 2, 9 Campbell Calcium Sensor: HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...

...Each antibody catalog item is tested for shipping stability by incubating at 37 °C for 2 weeks, freezing...recommended applications. The specific QC experiments performed varies for each antibody catalog item. Whenever...specific antibody can be found on the antibody's catalog page or by contacting [email protected] . Some of...Innovation (IPI). For these antibodies, IPI will be indicated as the Depositing Lab on the antibody webpage....cells and will interfere with conjugation. For applications such as these, the buffer can be removed by ...

...transient mammalian expression 101126 pACP-tag (m)- 2 Vector ACP/MCP-tag Empty backbone for stable and transient...compatible with multiple applications (different fluorophores, biotin, bead purification, blocking agents) ACP...formation in nonribosomal peptide biosynthesis. Catalytic role of the condensation domain. J Biol Chem. ...

...8661 p4455 FLAG-hPLIC-2 UBQLN2 Flag CMV ALS Peter Howley 8662 p4456 FLAG-hPLIC-2 NTF UBQLN2 Flag CMV ALS...196208 GB1-A11(2-196)-Strep ANXA11 His, Strep, Tev T7 ALS Lalit Deshmukh 196209 GB1-A11(2-196, G38R)-Strep...196210 GB1-A11(2-196, D40G)-Strep ANXA11 His, Strep, Tev T7 ALS Lalit Deshmukh 196211 GB1-A11(2-196, G175R...196212 GB1-A11(2-196, G189E)-Strep ANXA11 His, Strep, Tev T7 ALS Lalit Deshmukh 196213 GB1-A11(2-52)-Strep ...Spinocerebellar ataxia 22 Bernard Weinstein 21238 PKC gamma CAT PRKCG HA CMV Spinocerebellar ataxia 21 Bernard Weinstein...TLS 1: hTLS.pBSKS(+) FUS T7 ALS David Ron 21828 TLS 2: hTLS.pCDNA1 FUS CMV ALS David Ron 21829 TLS 3: TLS.pRSET.C...ApoE Alzheimer's Sohail Tavazoie 51436 pGL3Basic-ME.2/ApoEpromoter APOE ApoE Alzheimer's Sohail Tavazoie...

...dual-transgenic recombinase-expressing mouse lines 2–9 and combinations of transgenic recombinase-expressing...delivering additional recombinases 10–14 . Figure 2: INTRSECT works by inserting short, intronic sequences...inhibitory opsins , genetically-encoded calcium indicators, and rabies targeting genes. Recombinases Addgene...

...Gordon Fishell 83899-AAV1 pAAV-mDlx-GCaMP6f-Fishell-2 GCaMP6f expression in forebrain GABA-ergic interneurons...Gordon Fishell 83899-AAV9 pAAV-mDlx-GCaMP6f-Fishell-2 GCaMP6f expression in forebrain GABA-ergic interneurons...Gordon Fishell 83899-AAVrg pAAV-mDlx-GCaMP6f-Fishell-2 GCaMP6f expression in forebrain GABA-ergic interneurons... the human brain through the development and application of innovative tools enabling large-scale real-time...or when BRAIN Initiative grants are noted in publications associated with Addgene materials. Plasmids ...Gradinaru 105448-AAV9 pAAV-hSyn-DIO-ChrimsonR-mRuby2-ST Cation channelrhodopsin ChrimsonR fused to mRuby2 fluorophore...108912-AAV9 pAAV-CAG-DIO-ChroME-ST-P2A-H2B-mRuby3 Cation channelrhodopsin ChroME targeted to the neuronal...

...fusing NanoLuc® and Venus fluorophore to Troponin C Ca 2+ binding domain. Nano-lanterns , Enhanced Nano-lanterns...transfection Feng Zhang 21471 pLenti PGK V5-LUC Neo (w623-2) Firefly PGK Lentiviral expression of firefly luciferase...bacteria to aquatic animals to insects. Luciferase catalyzes the oxidation of a substrate, leading to the emission...advantages and disadvantages depending on the application. Firefly luciferase is considerably brighter ...luciferase-based plasmid systems for many different applications. Browse the Collection Highlights section to...respectively, for increased usefulness in in vivo applications. LuxSit-i : An artificial luciferase desined...

...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...BclI-SwaI none S. pyogenes URA3 Wyrick pCRISPomyces-2 61737 Bacteria BbsI yes, cut S. pyogenes Apramycin... S. pyogenes Zhang gRNA Cloning Vector Bbs I ver. 2 85586 Mammalian BbsI None S. pyogenes H Fujii pX601...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...

...sequence YFP Thorben Dammeyer 54520 mCherry-Peroxisomes-2 Peroxisome Peroximal Targeting Signal 1 (PTS1) mCherry...Centrin2 Centrioles (dependent on cell cycle) Centrin-2 EGFP Erich Nigg 41151 pEGFP Cep170 C-term Centrioles... Protein PI 71367 Human Beta-catenin GFP Adherens Junctions Beta-catenin EGFP Alpha Yap 67937 mouse E-...Michael Davidson 55001 mCherry-Beta-Catenin-20 Adherens Junctions Beta-Catenin mCherry Michael Davidson 30313...chaperones to help with folding or post-translational modification to function properly. Browse or search the table...

...AAV2 vectors in the mouse retina. Mol Ther . Feb;19(2):293-301. PMID: 21045809 Other citations include: ... any application Balanced Salt Solution (BSS) An ophthalmic solution suitable for any application TMN200...ordering information. ID Name Promoter Description Category PI 157970 pTR-UF11 chimeric CMV/Chicken Beta actin...When using the AAV2(Y444F) serotype in future publications, please acknowledge Arun Srivastava and cite...When using the AAV2(trpYF) serotype in future publications, please acknowledge Arun Srivastava and cite... using the AAV2(4pMut)dHS serotype in future publications, please acknowledge Shannon Boye and cite Boye...using the AAV6(dbY-F+T-V) serotype in future publications, please acknowledge Arun Srivastava and cite...

...Golden Gate TALEN Kit and are used in place of pTAL1, 2, 3, or 4. For both plasmids sequence positions 1214...Golden Gate TALEN kit. The GoldyTALEN scaffold is truncated at both the N and C terminus and induces mutation...pC-GoldyTALEN directs expression of TALENs from a truncated CAGs promoter. RCIscript-GoldyTALEN is designed...in vitro mRNA synthesis from the T7 promoter. Truncations were introduced to the N- and C-terminus of the...Golden Gate TALEN 2.0 48705 pTAL7a Boris Greber Application of TALEN technology in hPSCs pTAL7a and pTAL7b...expression in mammalian cells, (iv) an improved, truncated TALE backbone architecture as established by Miller...

...expression tTA Off Verma 26803 pEnt L1L3 EF1a-tTA-2 Contains Gateway L1L3 sites and EF1α promoter driving...Lentiviral, miRNA expression (PRIME) system for application in knockdown of gene expression at a single copy...

...lab collection for more) pLexA and pACT2.2 - Yeast 2-hybrid plasmids Fly UAS, MT Targeted... expression, transgenics and genome modification Species-Specific Expression If you want to drive...His or optimized YFP tags for purification or localization experiments Yeast...for bacterial expression (Gateway) GST Protein Purification pEBG - N-terminal GST for mammalian... packaging and expression. See our dedicated lentiviral plasmid page . Retroviral Easy and ...shRNA expression, transgenics and genome modification Element Details Representative Empty ...

...either (1) a lack of gRNA and/or Cas9 expression or (2) a lack of efficient target cleavage in cells expressing...Manipulation Select Expression System Design gRNA Publications Get Started CRISPR is a powerful system that...may not be a perfect plasmid for your specific application, and in such cases, it may be necessary to customize...reagent to suit your needs. Genetic Manipulation Application Cas9 gRNA Additional Considerations Knockout ...method Expression System Components of System Application Mammalian expression vector Cas enzyme promoter...gRNA complex, which is delivered to cells using cationic lipids Transient expression of CRISPR components...gene you target will depend on your specific application. For example: To activate or repress a target...

...Calcium sensor Ting 83899 pAAV-mDlx-GCaMP6f-Fishell-2 mDlx GCaMP6f expression under the control of the mDlx...the functional catagories listed below. Narrow down the items available within a category by using the ...experiments can be found on the material pages for viral catalog items. Browse Available Retrograde AAV See our ... Tools Clear Filters ID Name Promoter Activity Category PI 37825 AAV-CAG-GFP CAG GFP Control Boyden 51502...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...

...extraction solution, runs the protocol, then uses around 2-4ul in each 50ul PCR reaction. The gDNA extracted ... the target site sequence (protospacer+PAM) is located? If there are other PAMs in the region, will they...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Why does...

...- Bacterial Expression mScarlet-I3 568 592 68 4.2 2 min Monomer pmScarlet-I3_C1 - Mammalian Expression...No. 9, pp. 741-6 Shemiakina et al. : Nature Communications, November 2012, Vol. 3 No. 1204 Wiedenmann ... Vol. 11 No. 5, pp.572-8 Yu et al. : Nature Communications, May 2014 Vol. 15 No. 5, p. 3626 Do you have...