We narrowed to 106 results for: Ina
-
TypeCollection...tdTomato-N1 CyOFP1* mCardinal 497 0.76 659 87,000 0.19 6.7 6.5 pNCS-CyOFP , mCardinal-N1 mAmetrine* tdTomato...
-
Lentivirus Plasmids
TypeCollection...Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive or inducible expression...Fraser 15948 pLOVE 3rd Tet inducible gateway destination plasmid for cDNA expression. Miguel Ramalho-Santos... -
Plan Your Experiment
TypeCollection...RNA (gRNA), the design of the gRNA sequence, and finally how to validate your genetic edit. Figure 1: Flow...expression with AAVs can be long-lived, despite recombinant AAVs not integrating into the host genome. Scientists... -
Validated gRNA Sequences
TypeCollection... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740... -
Cell Migration Consortium Plasmids
TypeCollection...Consortium (CMC) Plasmids You may also like... Human Kinase ORF collection Fluorescent Protein Tools CRISPR... -
Synthetic Biology - Networks and Gene Regulation
TypeCollection...gene networks. Examples Include: promoters and terminators repressors and activators logic gates Networks... -
CRISPR Plasmids - dCas9-FokI
TypeCollection...Design Tools CRISPR Blog Posts A catalytically inactive Cas9 (dCas9) is fused to FokI nuclease. When FokI... -
Synthetic Biology - Cloning and Genomic Tools
TypeCollection...Reporters and Tags Library Construction Integration Recombination Shuttle Vectors Plasmids for Cloning and Genomic... -
KLF Research Plasmids
TypeCollection...feature of the KLF family is the presence of three C-terminal Krüppel-like zinc fingers which bind to CACCC ... -
CRISPR Plasmids - RNA Editing
TypeCollection...the catalytic domain of ADAR2(E488Q) adenosine deaminase to catalytically dead Cas13b creates a programmable... -
Cancer Research Plasmids and Resources
TypeCollection...Research Plasmids by Pathway mTOR mTOR is a protein kinase that anchors a signaling network for transitioning... -
AAV Viral Preps
TypeCollection...Channelrhodopsins, Halorhodopsins, Archaerhodopsins Recombinases Cre, Flp, Dre Biosensors Calcium Sensors, Glutamate... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...Genomic Loci Mammalian Resources Using catalytically inactive Cas9 (dCas9) fused to a fluorescent marker like... -
CRISPR Plasmids - gRNAs
TypeCollection...each plasmid for more information on how it was originally used. Here are a few questions to consider when... -
Chemogenetics Plasmids
TypeCollection...adding the luciferin substrate or by external illumination, making it a bimodal opto-chemogenetic actuator... -
CRISPR Plasmids and Resources
TypeCollection...multiple systems. RNA Editing Cas13 enzymes fused to deaminases can edit bases in RNA. Other Applications Screen... -
Serotype Testing AAV
TypeCollection...which is a sample of the purified DNA from the original plasmid that was used to make the virus. For more... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...including codon optimization, deletion of the C-terminal 18-21 amino acids and a D614G change which is ... -
Synthetic Biology - Assembly Standards Guide
TypeCollection...accomplished through the use of assembly standards – combinations of restriction sites which preserve a standard... -
AAV for Neuronal Tracing
TypeCollection... are naturally expressed at presynaptic nerve terminals. (4) Neurons projecting to the starter cell are...