Skip to main content
Addgene
Showing: 51 - 60 of 113 results

  1. AAV Viral Preps

    Type
    Collection
    ...Archaerhodopsins Recombinases Cre, Flp, Dre Biosensors Calcium Sensors, Glutamate Sensors, Voltage Reporters Controls...retrograde Retrograde AAV To target projection neurons Caltech Systemic Capsids PHP.eB, PHP.S, PHP.V1, MaCPNS1...serotypes AAV1, AAV2, AAV5, AAV8, AAV9, AAVrg, the Caltech systemic serotypes, or others, it will be listed...

  2. Plant Plasmids and Resources

    Type
    Collection
    ...repository contains many plasmid tools that were specifically designed for use in plants. These resources ...MoClo Plant Parts II and Infrastructure Kit for hierarchical assembly of plant multigene constructs - Johannes...an Old Favorite External Resources Arabidopsis Biological Resource Center (ABRC) (Link opens in a new window...

  3. Lentiviral Prep Service

    Type
    Collection
    ...libraries to screen for genes involved in specific biological processes. For more information, see our Guide...pooled libraries 92379 Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A Human CRISPRa... Accessories for Activating Gene Expression Catalytically-dead Cas9 (dCas9) can be fused to a transactivator...

  4. Validated gRNA Sequences

    Type
    Collection
    ...GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut...TGAAGAAGATGGTGCGCTC 58255 cut S. pyogenes 24870050 Goncalves Emx1 H. sapiens 42337 cut S. pyogenes 23287718...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article...GAATTTTCTGAAATTAAAGA 46169 cut S. pyogenes 23817069 Calarco unc-22 C. elegans GAACCCGTTGCCGAATACAC 58202 cut...

  5. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...Resources: Empty Backbones Biosensors Subcellular localization Optogenetics Background Förster resonance energy...acceptor molecules and can therefore be used to calculate the distances between the donor and acceptor. ...were developed to be used as FRET standards to calibrate the numerous and disparate methods used to measure...

  6. CRISPR Plasmids - Plants

    Type
    Collection
    ... Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein...Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator... Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...

  7. CRISPR Plasmids - Tagging

    Type
    Collection
    ...Masato Kanemaki's lab has developed a simple and scalable CRISPR/Cas-based method to tag endogenous proteins...Geraldine Seydoux's lab has developed a systematic and scalable method to create marker-free mutations, insertions...co-integrated markers or footprints, and can be scaled up for systematic editing of multiple genes. Plasmids...

  8. Zhang Lab CRISPR Page

    Type
    Collection
    ... genes. It consists of three components: A nucleolytically inactive Cas9-VP64 fusion A sgRNA incorporating... Return to SpCas9 plasmids GeCKO Library Genome-scale CRISPR-Cas9 knockout screening in human cells. Shalem...PubMed . Return to GeCKO Library SAM Library Genome-scale transcriptional activation by an engineered CRISPR-Cas9...

  9. TALEN Expression Vectors

    Type
    Collection
    ...methods yield TAL effector repeat arrays with identical DNA and amino acid sequences (i.e. only the details...vectors also have a FLAG epitope tag and nuclear localization signal at their amino-terminus. The expression...

  10. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...epigenetic modifications, researchers have fused catalytically dead dCas9 to epigenetic modifiers. Design your...and Interfere technologies also indirectly modify local chromatin state. Want more information on the wide...
Showing: 51 - 60 of 113 results