...Service AAV Chemogenetics Viral Vector Packaging Service: Chemogenetics AAV Use our chemogenetics AAV to chemically...Ready-to-use AAV available from Addgene's viral service encoding chemogenetics tools. Viral...in specific cell types. See our Chemogenetics Plasmids and Chemogenetics Guide pages for more information... Retrograde AAV Inventory Page . Browse all Chemogenetics AAV Don’t See What You’re Looking For? Our Packaged...

...Packaging Service AAV Optogenetics Viral Vector Packaging Service: Optogenetics AAV Optogenetic tools can be used... potentials in neurons. See our Optogenetics Plasmids and Optogenetics Guide page for more information...ready-to-use AAV preparations of optogenetics plasmids available in Addgene's collection. Opsin Excitatory...select plasmids in the repository. Browse our optogenetics AAV collection, including channelrhodopsins,...control cell activity in living tissue with light. Optogenetics is typically used in neuroscience to control...consider using fewer filtering options. Browse all Optogenetics AAV *AAVrg = retrograde serotype, produced with...

...an empty backbone can be repeated to ligate your gene of interest after the promoter, and so on. The following...

...adenoviral plasmids. Want an adenoviral plasmid with your gene of interest? Search our database for adenoviral ...capacity (>8 kb), high titers, and high levels of transgene expression. Additionally, these viruses are able...Disadvantages of adenoviruses include transient transgene expression, as well as the substantial immune ...transfected into mammalian packaging cell lines to generate adenovirus particles. Read our Adenoviral Guide...terms Adenoviral Strains Bacterial strains for generating adenovirus. ID Strain Description PI 16398 BJ5183... Shuttle For production of viruses containing transgene under a chosen promoter Vogelstein 16403 pShuttle-CMV... Shuttle For production of viruses containing transgene under CMV promoter Vogelstein 16404 pAdTrack Shuttle...

...currently available to industry scientists. ID Plasmid Gene/Insert PI Kits Kit name Type PI Description High...Packaging from Addgene Parkinson's Research from The Michael J Fox Foundation Search Use Addgene's Search to...protection for material providers. Addgene’s deposit agreements allow Addgene to distribute plasmids on behalf...can be submitted to Addgene through your user account or by email to mta@addgene.org . After we review ...A portion of Addgene’s collection is available to qualified for-profit entities. Addgene reserves the ...Addgene has a growing collection of plasmids that are available to industry. Learn more about the available...assembling standardized parts to create eukaryotic multigene constructs. Pooled Libraries Pooled Library name...

... distribution via Addgene. For a full list of Addgene's viral vectors See Addgene's Current AAV inventory... from the Penn Vector Core. Chemogenetics (including DREADDs) Optogenetics Recombinases Calcium Sensors... are now available for distribution at Addgene: Penn ID Addgene ID Name Function PI AV-1-49531P 100040...tdtomato Optogenetics Scott Sternson AV-1-20071P 20071-AAV1 pACAGW-ChR2-Venus-AAV Optogenetics Karel Svoboda...mCherry.WPRE.SV40 Optogenetics Karl Deisseroth AV-1-26966P 26966-AAV1 pAAV-Ef1a-DIO eNpHR 3.0-EYFP Optogenetics Karl...eYFP.WPRE.hGH Optogenetics Karl Deisseroth AV-1-26968P 26968-AAV1 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics Karl Deisseroth...EYFP Optogenetics Karl Deisseroth AV-1-26971P 26971-AAV1 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics Karl...

...Request: Scope of Service Addgene's Packaged on Request Service is subject to Addgene’s Terms of Purchase and... If Addgene determines that our current queue is too high and we do not expect to meet the general turnaround...with our materials, Addgene cannot guarantee the function of any viral vector. Addgene performs QC measures...produced through our Packaged on Request service, Addgene guarantees a titer of at least 4 x 10 12 GC/mL ... to toxicity or other reasons For these cases, Addgene will promptly notify you by email within a few ...expectations communicated by email will supersede the general guarantees above. We will have our expert viral...not yield the titer guaranteed here or by email, Addgene will contact you to offer some options for moving...

...fluorescent biosensors to measure biomolecules or genes via FRET or other assays....specific biomolecules, the activity of specific genes and cellular processes, or other factors like environmental...mitochondrial oxidative stress A novel MitoTimer reporter gene for mitochondrial content, structure, stress and...for a sensor for a different analyte, a sensor for gene-specific activity, or for popular biosensors in ... Cells", "mitochondria"). ID Plasmid Description Gene/Insert Vector Type PI Publication Return to Top ...also like... Addgene Blog: Biosensors Luciferase Plasmids Subcellular Localization Optogenetics Plasmids ...Gadella Calcium Teal genetically encoded calcium sensor T-GECI Blue-shifted genetically encoded Ca(2+) indicator...

...-mouse" or "anti-rabbit") ID Plasmid Description Gene/Insert PI Return to top Do you have suggestions ...Find information on Addgene's collection of plasmid-based antibodies, including monoclonal antibodies...Plasmid Collection Antibody Plasmid Collection Addgene distributes ready-to-use recombinant antibodies...application-specific validation and quality control by Addgene as well as by our trusted partner labs. Learn More...animals or hybridoma cells, but are difficult to generate due to expense and time. An alternative approach...fragment libraries from chickens Methods for the generation of chicken monoclonal antibody fragments by phage... 2015 Oct;167(2):95-102. Joanna Bereta Sybody Generation Toolbox for making synthetic nanobodies (sybodies...

...opsins , genetically-encoded calcium indicators, and rabies targeting genes. Recombinases Addgene ID Plasmid...definitions (e.g. neurons defined by a single gene or projection). Intersectional expression approaches ... in well-defined cellular sub-populations has generally been limited to single-component cellular definitions...cells based on a doubly-specified combination of genetic and/or anatomical-defined parameters, by placing...Operating Procedure (Link opens in a new window) with general principles for working with INTRSECT recombinases...pAAV-CaMKIIa-Flpo None Single recombinase-dependent Addgene ID Plasmid Logic Sites and Mutations 55641 pAAV-Ef1a-fDIO... Vcre Dual recombinase-dependent: Fluorophores Addgene ID Plasmid Logic Sites and Mutations 55650 pAAV-hSyn...

... disorders by enabling region- and cell-specific gene-delivery in the mouse brain through these human ...List of Pleiades MiniPromoters MiniPromoter Source Gene Construct Reporter Negative Control N/A pEMS1312...

...useful for the incorporation phosphoserine into your gene of interest....by adding this phosphorylated amino acid to the genetic code of E. coli (Park et al., Science 2011). Follow... in Mohler et al., Mol Syst Biol 2023 and find general tips on phosphoprotein expression in rEcoli XpS... Biotech. 2018). This phosphosite library was generated in a single mixed pool by expressing and purifying...phosphosite library ( 111704 ) is available from Addgene. This library is anticipated to be useful for laboratories...assessments. The mode #1 phosphosite library can be generated with either phosphoserine using SepOTSλ ( 68292...domain of NEDD4-2; 111705-8 ) is available from Addgene. Screening kinases. The mode #1 phosphosite library...

...are expressed as polycistronic glycine tRNA-gRNA genes (PTGs) and then PTG cassettes are assembled into...capable of simultaneously repressing multiple target genes in Escherichia coli. Koffas Do you have suggestions...BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein...elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock..., cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA 47108...

...Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into plasmids. Plasmids... tubulin (sometimes referred to as housekeeping genes). This allows for relative comparison of expression...Science Guides Antibody Guide Antibody Guide View Addgene's Antibody Collection Jump To: Antibody Guide Production...with myeloma cells (immortalized B cells). The genetic reorganization that creates variety in the antibody... be produced from plasmids, with an antibody’s genetic code inserted into the plasmid. This produces the...antibody is the antigen binding site. In B cells, the genetic region responsible for the variable region goes...epitopes on one antigen. Monoclonal antibodies are generated from cultured B cells, where each culture should...

...Abbreviations: AAV, adeno-associated virus; GRE, gene regulatory element; NHP, non-human primate. Image...Ready-to-use AAV available from Addgene's viral service. Engineered systemic constructs from Viviana ...As part of our Viral Vector Packaging Service , Addgene is distributing ready-to-use viral preparations...depth descriptions of each serotype, check out Addgene's blog on Systemic Capsids . To review performance...data of each of these serotypes, please refer to Addgene’s Data Hub and the Caltech CLOVER Center’s repository...produced with the pUCmini-iCAP-PHP.eB plasmid (Addgene #103005) . Note on PHP.eB tropism and specific ... BiSSTe4 dTomato/nlsdTomato Control Fishell Chemogenetics 44361 pAAV-hSyn-DIO-hM3D(Gq)-mCherry Syn Activator...

...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut S. pyogenes 23287722... cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017... 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes 25337876 Ventura...

...associated with Addgene materials. Plasmids ID Plasmid Description PI Viral Preps Addgene distributes ready-to-use...these antibodies are available at Addgene. AAV Viral Service . Addgene provides a viral service to help...the revolutionary dynamic picture of the brain generated through this effort will provide novel ways to...enables single cell, single millisecond resolution optogenetics. Human Synapsin (hSynapsin) promoter Edward ...enables single cell, single millisecond resolution optogenetics. Cre-dependent virus Edward Boyden 108422-AAV5...Hillel Adesnik 111066-AAV1 pAAV-hSyn-dLight1.1 To generate Adeno-Associated viruses for expression of dLight1.1...promoter Lin Tian 111067-AAV1 pAAV-CAG-dLight1.1 To generate Adeno-Associated viruses for expression of dLight1.1...

...helper plasmid (Addgene #81070) . This serotype permits robust retrograde access and transgene delivery to...Cre-dependent Optogenetics Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn Activator Optogenetics Deisseroth...Activator Optogenetics Svoboda 26975 pAAV-CaMKIIa-hChR2(H134R)-mCherry CamKII Activator Optogenetics Deisseroth...Flp-dependent Optogenetics Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn Activator Optogenetics Boyden 59170...Activator Optogenetics Boyden 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 mDIx Activator Optogenetics Fishell...Cre-dependent Optogenetics Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CamKII Inhibitor Optogenetics Boyden ...Cre-dependent Optogenetics Yizhar 125712 pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE CamKII Inhibitor Optogenetics Yizhar...

...distributed by Addgene have been produced in-house by Addgene scientists. They are generated using standard...or by contacting help@addgene.org . Some of the antibodies distributed by Addgene were developed by the...Overview of Addgene's antibody production methods and quality control processes for purified recombinant...optimized for each specific antibody in order to generate high quality preparations. Following production...titered and undergo stringent quality control by Addgene or a trusted quality control partner before distribution... preparations developed at IPI may differ from Addgene antibodies in “Production & Usage” and “Delivery...using ImageJ software and a standard curve is generated. The final antibody concentration is calculated...

...Browse Addgene's collection of recombinant monoclonal antibodies....application-specific validation and quality control by Addgene as well as by our trusted partner labs. On this...antibodies currently available from our catalog. Addgene values transparency and accessibility in research...reactivity. Reactivity is based on validation data from Addgene or trusted partner labs or is predicted based on... on sequence homology with the antigen. Addgene supplies a list of recommended applications based on our...immunohistochemistry, and immunocytochemistry. Addgene will continue to work with both depositing and ...to produce antibodies are available as part of Addgene’s larger Antibody Plasmid Collection , which also...