Skip to main content
Addgene

We narrowed to 157 results for: Gene

Showing: 121 - 140 of 157 results
  1. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...protein (FP) tags. Information on genes and associated neurodegenerative diseases was curated from several...but not exhaustive. If you do not see a particular gene of interest, please search our full plasmid collection... Huntington's Disease Parkinson's Disease Others Gene Type Wildtype Mutant Partial Sequence Codon-Optimized... T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI 1177 p416 25Q GPD HTT GFP... Neurodegeneration Neurodegeneration Plasmids Neurodegeneration Plasmid Collection Addgene has a ...Spinal muscular atrophy Eugene Yeo 156073 TARDBP TARDBP V5-MCP EF1a ALS Eugene Yeo 156883 pD649-HAsp-CSF1R-Fc...Parkinson's, FTD Eugene Yeo 214673 lucMAPT-30U MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214674 lucMAPT-GenRep...
  2. Chemogenetics AAV Preps

    Type
    Collection
    ...Service AAV Chemogenetics Viral Vector Packaging Service: Chemogenetics AAV Use our chemogenetics AAV to chemically...Ready-to-use AAV available from Addgene's viral service encoding chemogenetics tools. Viral...in specific cell types. See our Chemogenetics Plasmids and Chemogenetics Guide pages for more information... Retrograde AAV Inventory Page . Browse all Chemogenetics AAV Don’t See What You’re Looking For? Our Packaged...
  3. Optogenetics AAV Preps

    Type
    Collection
    ...Packaging Service AAV Optogenetics Viral Vector Packaging Service: Optogenetics AAV Optogenetic tools can be used... potentials in neurons. See our Optogenetics Plasmids and Optogenetics Guide page for more information...ready-to-use AAV preparations of optogenetics plasmids available in Addgene's collection. Opsin Excitatory...select plasmids in the repository. Browse our optogenetics AAV collection, including channelrhodopsins,...control cell activity in living tissue with light. Optogenetics is typically used in neuroscience to control...consider using fewer filtering options. Browse all Optogenetics AAV *AAVrg = retrograde serotype, produced with...
  4. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... distribution via Addgene. For a full list of Addgene's viral vectors See Addgene's Current AAV inventory... from the Penn Vector Core. Chemogenetics (including DREADDs) Optogenetics Recombinases Calcium Sensors... are now available for distribution at Addgene: Penn ID Addgene ID Name Function PI AV-1-49531P 100040...tdtomato Optogenetics Scott Sternson AV-1-20071P 20071-AAV1 pACAGW-ChR2-Venus-AAV Optogenetics Karel Svoboda...mCherry.WPRE.SV40 Optogenetics Karl Deisseroth AV-1-26966P 26966-AAV1 pAAV-Ef1a-DIO eNpHR 3.0-EYFP Optogenetics Karl...eYFP.WPRE.hGH Optogenetics Karl Deisseroth AV-1-26968P 26968-AAV1 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics Karl Deisseroth...EYFP Optogenetics Karl Deisseroth AV-1-26971P 26971-AAV1 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics Karl...
  5. Addgene Packaged on Request: Scope of Service

    Type
    Collection
    ...Request: Scope of Service Addgene's Packaged on Request Service is subject to Addgene’s Terms of Purchase and... If Addgene determines that our current queue is too high and we do not expect to meet the general turnaround...with our materials, Addgene cannot guarantee the function of any viral vector. Addgene performs QC measures...produced through our Packaged on Request service, Addgene guarantees a titer of at least 4 x 10 12 GC/mL ... to toxicity or other reasons For these cases, Addgene will promptly notify you by email within a few ...expectations communicated by email will supersede the general guarantees above. We will have our expert viral...not yield the titer guaranteed here or by email, Addgene will contact you to offer some options for moving...
  6. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...useful for the incorporation phosphoserine into your gene of interest....by adding this phosphorylated amino acid to the genetic code of E. coli (Park et al., Science 2011). Follow... in Mohler et al., Mol Syst Biol 2023 and find general tips on phosphoprotein expression in rEcoli XpS... Biotech. 2018). This phosphosite library was generated in a single mixed pool by expressing and purifying...phosphosite library ( 111704 ) is available from Addgene. This library is anticipated to be useful for laboratories...assessments. The mode #1 phosphosite library can be generated with either phosphoserine using SepOTSλ ( 68292...domain of NEDD4-2; 111705-8 ) is available from Addgene. Screening kinases. The mode #1 phosphosite library...
  7. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...are expressed as polycistronic glycine tRNA-gRNA genes (PTGs) and then PTG cassettes are assembled into...capable of simultaneously repressing multiple target genes in Escherichia coli. Koffas Do you have suggestions...BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein...elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock..., cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA 47108...
  8. Antibody Guide

    Type
    Collection
    ...Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into plasmids. Plasmids... tubulin (sometimes referred to as housekeeping genes). This allows for relative comparison of expression...Science Guides Antibody Guide Antibody Guide View Addgene's Antibody Collection Jump To: Antibody Guide Production...with myeloma cells (immortalized B cells). The genetic reorganization that creates variety in the antibody... be produced from plasmids, with an antibody’s genetic code inserted into the plasmid. This produces the...antibody is the antigen binding site. In B cells, the genetic region responsible for the variable region goes...epitopes on one antigen. Monoclonal antibodies are generated from cultured B cells, where each culture should...
  9. Caltech Systemic Capsids

    Type
    Collection
    ...Abbreviations: AAV, adeno-associated virus; GRE, gene regulatory element; NHP, non-human primate. Image...Ready-to-use AAV available from Addgene's viral service. Engineered systemic constructs from Viviana ...As part of our Viral Vector Packaging Service , Addgene is distributing ready-to-use viral preparations...depth descriptions of each serotype, check out Addgene's blog on Systemic Capsids . To review performance...data of each of these serotypes, please refer to Addgene’s Data Hub and the Caltech CLOVER Center’s repository...produced with the pUCmini-iCAP-PHP.eB plasmid (Addgene #103005) . Note on PHP.eB tropism and specific ... BiSSTe4 dTomato/nlsdTomato Control Fishell Chemogenetics 44361 pAAV-hSyn-DIO-hM3D(Gq)-mCherry Syn Activator...
  10. Validated gRNA Sequences

    Type
    Collection
    ...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut S. pyogenes 23287722... cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017... 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes 25337876 Ventura...
  11. Brain Initiative Collection

    Type
    Collection
    ...associated with Addgene materials. Plasmids ID Plasmid Description PI Viral Preps Addgene distributes ready-to-use...these antibodies are available at Addgene. AAV Viral Service . Addgene provides a viral service to help...the revolutionary dynamic picture of the brain generated through this effort will provide novel ways to...enables single cell, single millisecond resolution optogenetics. Human Synapsin (hSynapsin) promoter Edward ...enables single cell, single millisecond resolution optogenetics. Cre-dependent virus Edward Boyden 108422-AAV5...Hillel Adesnik 111066-AAV1 pAAV-hSyn-dLight1.1 To generate Adeno-Associated viruses for expression of dLight1.1...promoter Lin Tian 111067-AAV1 pAAV-CAG-dLight1.1 To generate Adeno-Associated viruses for expression of dLight1.1...
  12. Retrograde AAV viral preps

    Type
    Collection
    ...helper plasmid (Addgene #81070) . This serotype permits robust retrograde access and transgene delivery to...Cre-dependent Optogenetics Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn Activator Optogenetics Deisseroth...Activator Optogenetics Svoboda 26975 pAAV-CaMKIIa-hChR2(H134R)-mCherry CamKII Activator Optogenetics Deisseroth...Flp-dependent Optogenetics Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn Activator Optogenetics Boyden 59170...Activator Optogenetics Boyden 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 mDIx Activator Optogenetics Fishell...Cre-dependent Optogenetics Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CamKII Inhibitor Optogenetics Boyden ...Cre-dependent Optogenetics Yizhar 125712 pAAV-CaMKIIa(0.4)-eOPN3-mScarlet-WPRE CamKII Inhibitor Optogenetics Yizhar...
  13. Antibody Production

    Type
    Collection
    ...distributed by Addgene have been produced in-house by Addgene scientists. They are generated using standard...or by contacting help@addgene.org . Some of the antibodies distributed by Addgene were developed by the...Overview of Addgene's antibody production methods and quality control processes for purified recombinant...optimized for each specific antibody in order to generate high quality preparations. Following production...titered and undergo stringent quality control by Addgene or a trusted quality control partner before distribution... preparations developed at IPI may differ from Addgene antibodies in “Production & Usage” and “Delivery...using ImageJ software and a standard curve is generated. The final antibody concentration is calculated...
  14. All Antibodies

    Type
    Collection
    ...Browse Addgene's collection of recombinant monoclonal antibodies....application-specific validation and quality control by Addgene as well as by our trusted partner labs. On this...antibodies currently available from our catalog. Addgene values transparency and accessibility in research...reactivity. Reactivity is based on validation data from Addgene or trusted partner labs or is predicted based on... on sequence homology with the antigen. Addgene supplies a list of recommended applications based on our...immunohistochemistry, and immunocytochemistry. Addgene will continue to work with both depositing and ...to produce antibodies are available as part of Addgene’s larger Antibody Plasmid Collection , which also...
  15. Viral Prep Service for Plasmids and Pooled Libraries

    Type
    Collection
    ...vectors, and general biosafety guidelines. Addgene Blog: Viral Vector Posts Content from Addgene and scientists...production at Addgene, ordering information, and more. Additional Viral Vector Resources Addgene's Data Hub...Overview of Addgene's viral preparation service for plasmids and pooled libraries. Viral preparation ... Viral Vector Packaging Service Addgene produces high-quality viral vector preps from select...is a common step after requesting plasmids from Addgene, and by providing this service, we can save you... to do when you receive your viral vector from Addgene, with details about storage. Biosafety Guide Documentation... the Penn Vector Core have been transferred to Addgene for distribution. Look up the IDs of particular...
  16. Plasmid Collections

    Type
    Collection
    ... Addgene Homepage Plasmid Collections Addgene Plasmid Collections...Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus Adeno-associated...Browse Addgene’s curated collections of plasmids, kits, and pooled libraries. Find tools for CRISPR, ... proteins, optogenetics, biosensors, and more. Addgene...Collections Addgene's repository contains 161,273 plasmids . We've gathered our curated plasmid resources...Collection Bacterial Expression Systems Empty Backbones Genetic Code Expansion Immunology Mammalian RNAi Microbiology... Neuroendocrine Tumor Research Foundation Neurodegeneration Research Collection Rett Syndrome Plasmid ...
  17. DNA Service - Cloning Grade DNA

    Type
    Collection
    ...assistance at help@addgene.org . Don’t See What You’re Looking For? At this time, Addgene has made a limited...Grade DNA Service Details Plasmids Available FAQ Addgene is offering Cloning Grade DNA (cgDNA) for over ...start cloning upon arrival of their plasmid from Addgene – reducing the time to experiments by removing ...Standard Quality Control Plasmid verified by next generation sequencing Plasmids Available as Cloning Grade...the plasmid sequence has been validated by next generation sequencing. The DNA concentration and 260/280...resources or scientific support? Please see our Addgene Protocols for resources you may find helpful. Our... Please note that this does not guarantee that Addgene will make cloning grade DNA preps of this plasmid...
  18. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...Addgene's collection of plasmids for viral pseudotyping with SARS-CoV-2 spike protein....the live virus. Alternatively, it is possible to generate pseudovirus, where the structural and functional...protein and you will find examples of each in Addgene's collection: HIV-based lentiviral particles Murine...particles Vesicular stomatitis virus particles See Addgene's Viral Plasmids and Resources page for more information...lists expression plasmids that are suitable for generating pseudotyped virus for SARS-CoV-2 and other coronaviruses...Pseudotyped virus protocol for coronaviruses (184 KB) Addgene Blog Posts Viral Vectors 101: Pseudotyping Antibody...Pseudoviruses Expressing SARS-CoV-2 Spike Protein Variants Addgene COVID-19 Resources and Collections COVID-19 and...
  19. Fluorescent Protein Guide

    Type
    Collection
    ...intracellular processes with genetically encoded fluorescent biosensors. Optogenetics Plasmids | Guide Use light...actuators or sensors. Chemogenetics Plasmids | Guide Use small molecules to activate genetically engineered cellular... to find the plasmids that are available from Addgene's depositing scientists. Special...Protein Kits Blog: When is a Monomer not a Monomer? Addgene's plasmid repository contains a variety of fluorescent... to find the plasmids that are available from Addgene's depositing scientists. Browse Fluorescent Protein...
  20. Antibodies

    Type
    Collection
    ...Overview of Addgene's ready-to-use monoclonal recombinant antibody collection. These affinity reagents... Antibodies Addgene distributes ready-to-use recombinant antibodies...experimental data for recommended applications. Addgene values transparency and accessibility in research...All Antibodies Ready to use antibodies? Browse Addgene’s collection of antibodies developed and validated...Production Interested in our production process? At Addgene, we provide transparency in our production process...antibody. Antibody Blog Posts Recipient Instructions Addgene Help Center Antibody Protocols Looking for Antibody...
Showing: 121 - 140 of 157 results