We narrowed to 155 results for: Gene
-
TypeCollection...Long Overexpression Tools These AAV encode various genes for overexpression. ID Name Expression System Activity...Ready-to-use AAV available from Addgene's viral service encoding tet-off transactivators and tools for...see Monosynaptic Neuronal Tracers available at Addgene. ID Name Expression System Activity Serotype PI...
-
Fluorescent Protein Guide: Biosensors
TypeCollection...fluorescent biosensors to measure biomolecules or genes via FRET or other assays....specific biomolecules, the activity of specific genes and cellular processes, or other factors like environmental...mitochondrial oxidative stress A novel MitoTimer reporter gene for mitochondrial content, structure, stress and...for a sensor for a different analyte, a sensor for gene-specific activity, or for popular biosensors in ...mTORC1", "mitochondria"). ID Plasmid Description Gene/Insert Vector Type Eligible for Viral Packaging ... You may also like... Addgene Blog: Biosensors Luciferase Plasmids Optogenetics Plasmids Viral Service...Gadella Calcium Teal genetically encoded calcium sensor T-GECI Blue-shifted genetically encoded Ca(2+) indicator... -
Validated gRNA Sequences
TypeCollection...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut S. pyogenes 23287722... cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017... 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes 25337876 Ventura... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...are expressed as polycistronic glycine tRNA-gRNA genes (PTGs) and then PTG cassettes are assembled into...capable of simultaneously repressing multiple target genes in Escherichia coli. Koffas Do you have suggestions...BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein...elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock..., cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA 47108... -
Brain Initiative Collection
TypeCollection...associated with Addgene materials. Plasmids ID Plasmid Description PI Viral Preps Addgene distributes ready-to-use...these antibodies are available at Addgene. AAV Viral Service : Addgene provides a viral service to help...the revolutionary dynamic picture of the brain generated through this effort will provide novel ways to...enables single cell, single millisecond resolution optogenetics. Human Synapsin (hSynapsin) promoter Edward ...enables single cell, single millisecond resolution optogenetics. Cre-dependent virus Edward Boyden 108422-AAV5...Hillel Adesnik 111066-AAV1 pAAV-hSyn-dLight1.1 To generate Adeno-Associated viruses for expression of dLight1.1...promoter Lin Tian 111067-AAV1 pAAV-CAG-dLight1.1 To generate Adeno-Associated viruses for expression of dLight1.1... -
Retrograde AAV viral preps
TypeCollection...helper plasmid (Addgene #81070) . This serotype permits robust retrograde access and transgene delivery to...Cre-dependent Optogenetics Karl Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn Activator Optogenetics Karl Deisseroth...Flp-dependent Optogenetics Karl Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn Activator Optogenetics Edward ...Activator Optogenetics Edward Boyden 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 mDIx Activator Optogenetics Gordon...Cre-dependent Optogenetics Edward Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CamKII Inhibitor Optogenetics Edward...Inhibitor Optogenetics Ofer Yizhar 154948 CaMKII-somBiPOLES-mCerulean CamKII Bidirectional Optogenetics Simon...Ready-to-use retrograde AAV available from Addgene's viral service. Retrograde construct from Alla Karpova... -
Antibody Production
TypeCollection...distributed by Addgene have been produced in-house by Addgene scientists. They are generated using standard...or by contacting help@addgene.org . Some of the antibodies distributed by Addgene were developed by the...Overview of Addgene's antibody production methods and quality control processes for purified recombinant...optimized for each specific antibody in order to generate high quality preparations. Following production...titered and undergo stringent quality control by Addgene or a trusted quality control partner before distribution... preparations developed at IPI may differ from Addgene antibodies in “Production & Usage” and “Delivery...using ImageJ software and a standard curve is generated. The final antibody concentration is calculated... -
Caltech Systemic Capsids
TypeCollection...Abbreviations: AAV, adeno-associated virus; GRE, gene regulatory element; NHP, non-human primate. Image...Ready-to-use AAV available from Addgene's viral service. Engineered systemic constructs from Viviana ...As part of our Viral Vector Packaging Service , Addgene is distributing ready-to-use viral preparations...depth descriptions of each serotype, check out Addgene's blog on Systemic Capsids . To review performance...data of each of these serotypes, please refer to Addgene’s Data Hub and the Caltech CLOVER Center’s repository...produced with the pUCmini-iCAP-PHP.eB plasmid (Addgene #103005) . Note on PHP.eB tropism and specific ... BiSSTe4 dTomato/nlsdTomato Control Fishell Chemogenetics 44361 pAAV-hSyn-DIO-hM3D(Gq)-mCherry Syn Activator... -
Viral Prep Service for Plasmids and Pooled Libraries
TypeCollection...vectors, and general biosafety guidelines. Addgene Blog: Viral Vector Posts Content from Addgene and scientists... production at Addgene, ordering information, and more. Additional Resources Addgene's Data Hub Curated...Overview of Addgene's viral preparation service for plasmids and pooled libraries. Viral preparation ... Viral Vector Packaging Service Addgene offers flexible packaging options so you can easily...viral vector is produced from a cargo plasmid in Addgene’s collection. These plasmids are created by your... to do when you receive your viral vector from Addgene, with details about storage. Biosafety Guide Documentation... the Penn Vector Core have been transferred to Addgene for distribution. Look up the IDs of particular... -
All Antibodies
TypeCollection...Browse Addgene's collection of recombinant monoclonal antibodies....Antibodies Addgene distributes ready-to-use recombinant antibodies. These monoclonal antibodies undergo application-specific...application-specific validation and quality control by Addgene as well as by our trusted partner labs. On this...antibodies currently available from our catalog. Addgene values transparency and accessibility in research...reactivity. Reactivity is based on validation data from Addgene or trusted partner labs or is predicted based on... on sequence homology with the antigen. Addgene supplies a list of recommended applications based on our...immunohistochemistry, and immunocytochemistry. Addgene will continue to work with both depositing and ... -
Fluorescent Protein Guide
TypeCollection...processes with genetically encoded fluorescent biosensors. Optogenetics Guide | Optogenetics Plasmids Use...signals, cells, or groups of cells. Chemogenetics Guide | Chemogenetics Plasmids Use small molecules to activate...100 empty backbones. Additional Resources at Addgene Addgene Blog: Fluorescent Proteins Luciferase Plasmid... to find the plasmids that are available from Addgene's depositing scientists. Plasmid... Fluorescent Proteins: Plasmids and Resources Addgene's plasmid repository contains thousands of fluorescent... activate or inhibit genetically engineered cellular receptors that affect signalling pathways within ... -
Plasmid Collections
TypeCollection... Addgene Homepage Plasmid Collections Addgene Plasmid Collections...Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus Adeno-associated...Browse Addgene’s curated collections of plasmids, kits, and pooled libraries. Find tools for CRISPR, ... proteins, optogenetics, biosensors, and more. Addgene...Collections Addgene's repository contains 164,845 plasmids . We've gathered our curated plasmid resources...Collection Bacterial Expression Systems Empty Backbones Genetic Code Expansion Immunology Mammalian RNAi Microbiology... Neuroendocrine Tumor Research Foundation Neurodegeneration Research Collection Rett Syndrome Plasmid ... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...for the incorporation of phosphoserine into your gene of interest....phosphoserine into the growing polypeptide chain to generate the new phosphorylated protein. Protein Phosphorylation...by adding this phosphorylated amino acid to the genetic code of E. coli (Park et al., 2011). Follow up ...further details in Mohler et al. (2023) and find general tips on phosphoprotein expression in rEcoli XpS...Barber et al., 2018). This phosphosite library was generated in a single mixed pool by expressing and purifying...assessments. The Mode #1 phosphosite library can be generated with either phosphoserine using SepOTSλ (Plasmid...synthesized using supD tRNA ( SupD (Plasmid #68307) ) to generate the phosphosites with serine instead of phosphoserine... -
Antibody Guide
TypeCollection...Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into plasmids. Plasmids... tubulin (sometimes referred to as housekeeping genes). This allows for relative comparison of expression...Science Guides Antibody Guide Antibody Guide View Addgene's Antibody Collection Jump To: Antibody Guide Production...with myeloma cells (immortalized B cells). The genetic reorganization that creates variety in the antibody... be produced from plasmids, with an antibody’s genetic code inserted into the plasmid. This produces the...antibody is the antigen binding site. In B cells, the genetic region responsible for the variable region goes...epitopes on one antigen. Monoclonal antibodies are generated from cultured B cells, where each culture should... -
DNA Service - Cloning Grade DNA
TypeCollection...assistance at help@addgene.org . Don’t See What You’re Looking For? At this time, Addgene has made a limited...Grade DNA Service Details Plasmids Available FAQ Addgene is offering Cloning Grade DNA (cgDNA) for over ...start cloning upon arrival of their plasmid from Addgene – reducing the time to experiments by removing ...Standard Quality Control Plasmid verified by next generation sequencing Plasmids Available as Cloning Grade...the plasmid sequence has been validated by next generation sequencing. The DNA concentration and 260/280...resources or scientific support? Please see our Addgene Protocols for resources you may find helpful. Our... Please note that this does not guarantee that Addgene will make cloning grade DNA preps of this plasmid... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection...Browse Addgene's COVID-19 collection of SARS-CoV-2 spike plasmids, packaging plasmids, and reporter plasmids...the live virus. Alternatively, it is possible to generate pseudovirus, where the structural and functional...protein and you will find examples of each in Addgene's collection: HIV-based lentiviral particles Murine...particles Vesicular stomatitis virus particles See Addgene's Viral Plasmids and Resources page for more information...lists expression plasmids that are suitable for generating pseudotyped virus for SARS-CoV-2 and other coronaviruses...virus protocol for coronaviruses (DOCX, 184 KB) Addgene Blog Posts Viral Vectors 101: Pseudotyping Antibody...Pseudoviruses Expressing SARS-CoV-2 Spike Protein Variants Addgene COVID-19 Resources and Collections COVID-19 and... -
Antibodies
TypeCollection...Overview of Addgene's ready-to-use monoclonal recombinant antibody collection. These affinity reagents... Antibodies Addgene distributes ready-to-use recombinant antibodies...experimental data for recommended applications. Addgene values transparency and accessibility in research...All Antibodies Ready to use antibodies? Browse Addgene’s collection of antibodies developed and validated...Production Interested in our production process? At Addgene, we provide transparency in our production process...antibody. Antibody Blog Posts Recipient Instructions Addgene Help Center Antibody Protocols Looking for Antibody... -
NETRF
TypeCollection...Addgene Depositors that have received funding from the Neuroendocrine Tumor Research Foundation...around the world. The NETRF is grateful for the generous support of philanthropic individuals and foundations...Ramesh Shivdasani Dana-Farber Cancer Institute Epigenetic Regulators of Intestinal Endocrine Cells and ...Carcinoid Tumors Qiao Zhou Harvard University Epigenetic Regulators of Intestinal Endocrine Cells and ...Bernstein Broad Institute Identifying Altered Epigenetic States and Drivers in Intestinal Carcinoid and... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...England Biolabs has deposited plasmids at Addgene to generate SNAP, CLIP, ACP or MCP tagged plasmids for...associated with this technology are available at Addgene for distribution to the research community. Key...synthases needed for use of these tags. Plasmids Addgene ID Plasmid Substrate Feature 101137 pSNAP-tag (...and the ACP and SFP Synthases. Users may still generate their own fluorescent or non-fluorescent CoA substrates... -
Fluorescent Proteins: FRET
TypeCollection...Fixed Cells Additional Resources at Addgene Learn more on the Addgene Blog: Introduction to FRET and Tips...many FRET-based biosensors in Addgene's Biosensors Collection . Generate custom FRET-based biosensors ...Bioluminescence Resonance Energy Transfer (BRET) . Browse Addgene's Luciferase Plasmid Collection or the Promega Plasmid...