We narrowed to 41 results for: HAL
-
TypeCollection...SynBio Blog Genome Engineering SynBio Depositing Labs Hal Alper J. Chris Anderson Adam Arkin Gabor Balazsi ...
-
Neurodegeneration Plasmid Collection
TypeCollection... 161767 FUS_Halo_N_allele_400 FUS Halo ALS Michael Ward 161768 FUS_Halo_C_allele_400 FUS Halo ALS Michael...Melcher 178115 ANG_Halo_C_allele ANG Halo ALS Michael Ward 178116 PRNP_Halo_C_allele PRNP Halo Dementia Michael...178117 PFN1_Halo_C_allele PFN1 Halo ALS Michael Ward 178118 CHCHD10_Halo_N_allele CHCHD10 Halo ALS Michael...178119 UBQLN2_Halo_C_allele UBQLN2 Halo ALS Michael Ward 178120 SIGMAR1_Halo_C_allele SIGMAR1 Halo ALS Michael...178121 APOE_Halo_C_allele APOE Halo Alzheimer's Michael Ward 178122 TREM2_Halo_N_allele TREM2 Halo Alzheimer's... 178123 HNRNPA1_Halo_C_allele HNRNPA1 Halo ALS Michael Ward 178125 GRN_Halo_C_allele GRN Halo Frontotemporal...178133 PSEN2_Halo_C_allele PSEN2 Halo Alzheimer's Michael Ward 178134 POLG_Halo_C_allele POLG Halo Parkinson's... -
Genetic Code Expansion
TypeCollection... 160377 pDule-Mb haloTyrRS C6 C6 HaloTyrosine tRNA synthatase M. barkeri Halotyrosine Amino Acids Bacterial...160378 pDule2-Mb haloTyrRS C6 C6 HaloTyrosine tRNA synthatase M. barkeri Halotyrosine Amino Acids Bacterial...pylRS nitroY/haloY-F5 PylRS M. alvus 3-nitrotyrosine (3-nitro-Y), 3-halotyrosine (3-halo-Y) Bacterial ...barkeri Mammalian Ryan Mehl 141174 pAcBac1-haloTyrRS C6 C6 HaloTyrosine tRNA synthatase E. coli Mammalian Ryan...Because there are no free codons, this can be challenging. In E.coli , the rarest codon is the amber stop...Peter Schultz 48696 pANAP AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian..._4xEcoLeuT(CUA)_AnapRS AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian... -
Promega Plasmid Collection
TypeCollection...protein dynamics in highly scalable assays. HaloTag Fusions HaloTag (Link opens in a new window) technology...fusion vectors containing tags such as NanoLuc, HaloTag, SmBiT, and LgBiT, useful for detecting and tracking... tracking proteins using tags such as NanoLuc, HaloTag, SmBiT, and LgBiT. Ordering & Availability Plasmids...such as "NFAT", "luciferase", "Ras", "NanoLuc", "HaloTag", "BiT", or other terms. ID Plasmid Description...applications. The technology includes NanoLuc, HaloTag, SmBiT, LgBiT, HiBiT, and more. Luciferase Reporters...your hands, thanks to interchangeable ligands. HaloTags form a covalent bond with these synthetic chemical...even customize ligands for your specific purpose. HaloTag technology is optimized for various protein expression... -
Validated gRNA Sequences
TypeCollection...26355004 Mendenhall CEBPB H. sapiens GCCGGCAGGGGGACGCGCGCGG 64047 tag S. pyogenes 26355004 Mendenhall Cent1...26355004 Mendenhall CREB1 H. sapiens GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-...26355004 Mendenhall GABPA H. sapiens TTTGGAGTCTCAGAATGTCCTGG 64255 tag S. pyogenes 26355004 Mendenhall GAL4... Kim BRI1 A. thaliana TTTGAAAGATGGAAGCGCGG cut S. pyogenes 26479191 Kim BRI1 A. thaliana TGAAACTAAACTGGTCCACA...TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM H. sapiens TGAATTGGGATGCTGTTTTT 58779 cut... pyogenes 23792628 Joung ETC2, TRY, and CPC A. thaliana 71288 cut S. pyogenes 26193878 Chen FANCF H. sapiens... 49772 cut S. pyogenes 24112467 Kamoun PDS3 A. thaliana GGACTTTTGCCAGCCATGGT 52255 cut S. pyogenes 23929339... -
Biosensor AAV Preps
TypeCollection...Campbell Calcium Sensor: HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP Syn HaloCaMP1a EGFP Constitutive 1...Schreiter Calcium Sensor: HaloCaMP1b 138328 pAAV-synapsin-HaloCaMP1b-EGFP Syn HaloCaMP1b EGFP Constitutive 1...jRGECO1 sRGECO Far-Red/NIR Calcium Sensors HaloCaMP1a HaloCaMP1b NIR-GECO Acetylcholine Sensors iAChSnFR ...Sensors 209655 pAAV.CAGFLEX.(cyto).iATPSnFR2.S29W.A95K.HaloTag CAG iATPSnFR2 none Constitutive 5 Brown , ... -
CRISPR Plasmids - Tagging
TypeCollection... your gene of interest Mendenhall and Myers Tagging System The Eric Mendenhall and Richard Myers labs ...homology arm cloning: Mendenhall & Myers FETCh-seq Protocol 134.7 KB Mendenhall and Myers Tagging Plasmids... the homology arms for the donor plasmid. The Mendenhall and Myers labs have also provided their protocol... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection... Method Full Target Site (5' to 3') Left half-site Right half-site CACNA1F OZ507 and OZ508 OPEN OPEN gCGTGACCTCgctgatAAGAAGAGg...on the length of the spacer sequence between the half-sites (see Nuclease Expression Vectors for more ...and OZ540 OPEN OPEN tTGCATCCACggcagTCGGCAGTGc Encephalopsin (Opn3) OZ541 and OZ542 OPEN OPEN aTCCATCCCAaacacatGTGGCAGAAt... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Podgorski Calcium HaloCaMP1 chemigenetic calcium indicator for fluorescence using HaloTag ligands Bright ...Schreiter Calcium WHaloCaMP1 chemigenetic calcium indicator for fluorescence using HaloTag ligands A modular...30875-83. Wolf Frommer Trehalose Single fluorescent protein biosensor for trehalose Rapid construction of...Proc Natl Acad Sci U S A. 2019 Aug 1. Alexander Gottschalk Voltage Near-infrared fluorescent voltage indicator... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...were not plated, freeze half of the cells for future plating. Plate the other half for screening and primer...using the Qiagen Miniprep Kit. Zhang S, Cahalan MD. J. Vis. Exp . 2007. PubMed . Transformation... using the heat shock method. Froger A, Hall JE. J. Vis. Exp . 2007. PubMed . Molecular cloning... -
Zhang Lab CRISPR Page
TypeCollection..., Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, Cradick TJ, Marraffini LA, Bao G, Zhang F. Nat... CRISPR-Cas9 knockout screening in human cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods . 2014 Aug;11(8):783-4....WX, Scott DA, Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang... -
CRISPR Guide
TypeCollection...less widely used in bacteria due to technical challenges, bacterial CRISPR libraries have been developed... S., Agarwala, V., Li, Y., Fine, E. J., Wu, X., Shalem, O., Cradick, T. J., Marraffini, L. A., Bao, G....., Gootenberg, J. S., Kriz, A. J., Zetsche, B., Shalem, O., Wu, X., Makarova, K. S., Koonin, E. V., Sharp...790. PMID: 38216671 Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S., & Sternberg, S. H. (2019). Transposon-encoded...Communications . 9 (11), e1007749. PMID: 30575746 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott...cells. Science . 343 (6166), 84–87. PMID: 24336571 Shalem, O., Sanjana, N. E., & Zhang, F. (2015). High-throughput...Meadows, S. K., Roberts, B. S., Mackiewicz, M., Mendenhall, E. M., & Myers, R. M. (2015). CETCh-seq: CRISPR... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...AiE0027m_3xC3 SYFP2 Ventromedial hypothalamic nucleus (VMH) Hypothalamus 230531 pAAV-AiE2150m-minBG-SYFP2...formation Cortical subplate Striatum Pallidum Hypothalamus Cerebellum Whole brain Addgene ID Plasmid Allen...Gore BB, Graybuck L, Greisman N, Haeseleer F, Halterman C, Helback O, Hockemeyer D, Huang C, Huff S, Hunker... -
Distribution to Industry
TypeCollection...Information Featured Collections NEW NanoLuc and HaloTag Fusions from Promega COVID-19 SARS-COV-2, ACE2,...agreements allow Addgene to distribute plasmids on behalf of the depositing institutions. These agreements...signatory is someone who can execute legal documents on behalf of the recipient institution. Once the MTA has ... -
Plant Plasmids and Resources
TypeCollection...distributes diverse seed and other stocks of Arabidopsis thaliana and related species. The Arabidopsis Information...genetic and molecular biology data for Arabidopsis thaliana research. BAR The Bio-Analytic Resource for Plant...Database of gene expression profiles in Arabidopsis thaliana based on RNA-seq analysis. Return to top Do you... -
TALEN Plasmids and Kits
TypeCollection...TALEN Kit 49042 EMM65 Bradley Bernstein and Eric Mendenhall The TALE plasmid vectors described on this page...4 (H3K4) di-methylation at the target locus ( Mendenhall et al., 2013 ). This epigenome editing was also...49044 EMM71T Golden Gate TALEN 2.0 49401 pBlue-TAL Michal Zurovec pBlue-TAL was designed for use with the... -
Rett Syndrome
TypeCollection... results in approximately half of cells expressing wild-type MECP2 and half expressing mutant MECP2 . ...Kankirawatana et al. 2006. Early progressive encephalopathy in boys and MECP2 mutations. Neurology . 67... -
Deisseroth INTRSECT Collection
TypeCollection..., Deisseroth K, Carlén M, Meletis K. 2019. A hypothalamus-habenula circuit controls aversion. Mol. Psychiatry... Osten P, Sabatini BL. 2019. Distinct Cortical-Thalamic-Striatal Circuits through the Parafascicular Nucleus...window) Marcinkiewcz CA, Mazzone CM, D'Agostino G, Halladay LR, Hardaway JA, DiBerto JF, Navarro M, Burnham... -
Luciferase Plasmid Collection
TypeCollection...firefly and Renilla luciferase have short protein half-lives, making them useful as transcriptional reporters...Constructs using NanoLuc® as a BRET energy donor and HaloTag labeled with a fluorophore as the acceptor. LumiFluors...TREAT : Biosensor using Renilla luciferase and a Halo tag to assay mRNA turnover in real time. Nonsense-mediated... -
CRISPR History and Development for Genome Engineering
TypeCollection...WX, Scott DA, Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang...Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. 2015. CETCh-seq: CRISPR epitope...proteins. Genome Res . 25(10):1581-9. PMID: 26355004 Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson...