Skip to main content
Addgene

We narrowed to 104 results for: Nes

Showing: 1 - 20 of 104 results
  1. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...Pre-constructed pairs of TALEN plasmids targeting zebrafish genes....target sites within various endogenous zebrafish genes; many of these were generated as part of an NIH-...TGCCTGGCACAGGGGCTctccaccatgctggccAACCTGTTCTCAATGA kinesin-family-member-13a TAL3106 & TAL3107 TGTTCTCTGTTTGAGCGAgtctccacacagcagaGCGACAGTAACAGCTTCA...
  2. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...in Mammalian Cell Lines CRISPR: Protocol for Genomic Deletions in Mammalian Cell Lines Other Addgene Resources...loss-of-function studies of genes and genetic elements in mammalian cell lines. Protocol For referenced ...CRISPR/Cas9 Clones for Deletions and Clone Selection For suspension cells, transfer all clones to a single...Validation of Biallelic Deletion Clones In order to characterize obtained clones and validate a successful knockout...JoVE) about genomic deletions in mammalian cell lines using CRISPR/Cas9 CRISPR...Cas9 to create genomic deletions in mammalian cell lines. Along with the video, you can find the protocol...Generation of Genomic Deletions in Mammalian Cell Lines via CRISPR/Cas9. Bauer DE, Canver MC, Orkin SH. ...
  3. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Fluorescent Protein Guide Empty Backbones Fluorescent Protein Guide: Empty Backbones More Fluorescent Protein...Addgene has assembled a collection of empty plasmid backbones with different fluorescent tags for you to create...generated with the help of Erik Snapp . Empty Backbones for Fluorescent Protein Fusions (Organized by ...Excitation and Emission maximum are listed in nm. Brightness is the product of exctinction coefficient and...Blue/UV Protein Excitation (nm) Emission (nm) Brightness pKa Maturation Structure Plasmids Sirius 355 ...Top Cyan Protein Excitation (nm) Emission (nm) Brightness pKa Maturation Structure Plasmids Aquamarine ...
  4. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ... Collections Empty Backbones Choosing Your Perfect Plasmid Backbone Empty backbones are plasmids containing...A selection of Addgene's empty vector backbones curated by species, epitope tags/fusion proteins, function...guide to a selection of Addgene's empty vector backbones. For the most part, we will assume that you want... Host Relevant Promoters Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG, Ubc Transient ...- Tet-inducible Find more Tet-inducible empty backbones on our Tetracycline (Tet) Inducible Expression...Hygromiycin resistance marker Also see more empty backbones on our Plant Plasmids and Resources collection...Protein Common uses Representative Empty Backbones Flag Epitope tag c-Flag pcDNA3 or FLAG-HA-pcDNA3.1...
  5. Brain Initiative Collection

    Type
    Collection
    ...the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1m in neurons Yulong Li 123308-AAVrg...the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1m in neurons Yulong Li 123309-AAV9...the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1h in neurons Yulong Li 123309-AAVrg...the genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1h in neurons Yulong Li 123310-AAV9...the genetically-encoded fluorescent norepinephrine(NE) control sensor GRAB_NEmut in neurons Yulong Li 123310...the genetically-encoded fluorescent norepinephrine(NE) control sensor GRAB_NEmut in neurons Yulong Li 125560...combination with Cre-dependent transgenic mouse lines or co-infection with Cre dependent viral vectors...
  6. Retrograde AAV viral preps

    Type
    Collection
    ...Syn genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1m Norepinephrine sensor Li 123309...Syn genetically-encoded fluorescent norepinephrine(NE) sensor GRAB_NE1h Norepinephrine sensor Li 123310...control norepinephrine sensor (does not respond to NE) Norepinephrine sensor Li 20297 pAAV-EF1a-double ...serotype to deliver Cre-dependent transgenes in Cre transgenic lines. As part of our standard viral production...nuclear dTomato Calcium sensor Ting 100853 pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 Syn Cre-dependent jRGECO1a...jRGECO1a Calcium Sensor Kim , GENIE 100854 pAAV.Syn.NES-jRGECO1a.WPRE.SV40 Syn jRGECO1a Calcium Sensor Kim...
  7. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pcDNA3.1-hSNCA-NE SNCA NE CMV Parkinson's Shu Leong Ho 102363 pcDNA3.1-hNurr1-NE NR4A2 NE CMV Parkinson's...pSIN-PAmCherry-mSNCA-NE SNCA NE EF-1 alpha Parkinson's Shu Leong Ho 102366 pSIN-hSNCA-NE SNCA NE EF-1 alpha Parkinson's...215486 FUW-hSNCA-NE SNCA NE Ubc Parkinson's Ophir Shalem 215487 FUW-hSNCA(D2R)-NE SNCA NE Ubc Parkinson'...Alzheimer's Hélène Marie 107544 pAAV-AICD-NES-IRES-hrGFP APP V5 CMV Alzheimer's Hélène Marie 107548 pAAV-syn-AICD-IRES-hrGFP...Parkinson's Ophir Shalem 215488 FUW-hSNCA(D2E)-NE SNCA NE Ubc Parkinson's Ophir Shalem 215489 FUW-hSNCA-GFP SNCA...pAAV-syn-AICD-IRES-hrGFP APP hSyn1 Alzheimer's Hélène Marie 107594 pCS2-sod1 SOD1 SP6 ALS Qing Deng 107798...SFFV Parkinson's Denes Hnisz 145270 pHR-TBP(53Q)-IDR-mCherry-Cry2-NLS TBP Parkinson's Denes Hnisz 145283 ...
  8. Zhang Lab CRISPR Page

    Type
    Collection
    ...knockout screening in human cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen TS, Heckl...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods . 2014 Aug;11(8):...contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming...CRISPR-mediated nucleic acid cleavage. We have harnessed the type II CRISPR nuclease system to facilitate...implemented in mammalian cells by co-expressing the S. pyogenes Cas9 (SpCas9) nuclease along with the guide RNA...for the transcriptional activation of endogenous genes. It consists of three components: A nucleolytically..., Nature 2015). The dual vector system uses S. pyogenes Cas9 (SpCas9), using one vector to express SpCas9...
  9. Biosensor AAV Preps

    Type
    Collection
    ...SF-iGluSnFr Glucose Sensors iGlucoSnFr Norepinephrine (NE) Sensors GRAB_NE nLight Oxytocin (OT) Sensors GRAB_OT...iGlucoSnFr mRuby2 Constitutive 9 Looger Norepinephrine (NE) Sensors 123308 pAAV-hSyn-GRAB_NE1m Syn GRAB_NE1m... Griesbeck Calcium Sensor: jRCaMP1 100846 pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40 CAG jRCaMP1a none Cre dependent... dependent 1 Kim , GENIE 100848 pAAV.Syn.NES.jRCaMP1a.WPRE.SV40 Syn jRCaMP1a none Constitutive 1, 9 Kim...Kim , GENIE 100849 pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 CAG jRCaMP1b none Cre dependent 1 Kim , GENIE ...GENIE 100850 pAAV.Syn.Flex.NES-jRCaMP1b.WPRE.SV40 Syn jRCaMP1b none Cre dependent 1 Kim , GENIE 100851 pAAV.Syn.NES-jRCaMP1b.WPRE.SV40...CaMPARI none Constitutive 1, 5, 9 Looger 101060 pAAV_hsyn_NES-his-CaMPARI2-WPRE-SV40 Syn CaMPARI2 his Constitutive...
  10. Genetic Code Expansion

    Type
    Collection
    ...Bacterial TAG Ryan Mehl 174081 pAcBac1-NES-Flag-R2-84-MbRS Tetrazine3.0 NES-Flag-R2-84 tRNA synthetase M. barkeri...growth medium, ncAA concentration, and the cell lines used previously. Remember that the orthogonal pairs...aminoacylate only the orthogonal tRNA, and not endogenous ones. Endogenous synthetases cannot aminoacylate the ...mazei Mammalian TGA Simon Elsaesser 174901 pAS_MmaPylT_EF1_NES-MmaPylRS WT PylRS M. mazei Mammalian TAG ...TAG Simon Elsaesser 174902 pAS_MmaPylT_EF1_NES-MmaPylRS AF PylRS (Y306A, Y384F) M. mazei Mammalian TAG Simon...Thomas Huber 182287 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF) Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA synthetase...TAA Wenshe Liu 182653 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA Y306A/Y384F (AF) pyrrolysine...
  11. CRISPR History and Development for Genome Engineering

    Type
    Collection
    .... 25(10):1581-9. PMID: 26355004 Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl... anti-CRISPR genes in bacteriophages infecting Pseudomonas aeruginosa . Anti-CRISPR genes employ varied...system - utilizing various CRISPR-associated (Cas) genes to not only store a record of invading phages but...Cas proteins. Makarova et al. ’s classification defines 5 types and 16 subtypes based on shared characteristics...genomic DNA. Type II CRISPR was the first system harnessed for genome engineering, with Type V following ...Csf1) Type VI (Cas13) Fighting Back: Anti-CRISPR Genes in Phage The CRISPR adaptive immune system seems.... Pooled gRNA libraries can be used to identify genes that are important to a given phenotype. Current...
  12. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...pmTurquoise2-NES Non-nucleus Nuclear Export Sequence mTurquoise2 Dorus Gadella 85062 pmScarlet-i_NES_C1 Non-nucleus...pmScarlet-H_NES_C1 Non-nucleus Nuclear Export Sequence mScarlet-H Dorus Gadella 85060 pmScarlet_NES_C1 Non-...Plasmids encoding fluorescent proteins tagged with genes or peptides with known subcellular localization ...Localization More Fluorescent Protein Resources: Empty Backbones Allen Institute for Cell Science Plasmid Collection...proteins that enter the secretory pathway require chaperones to help with folding or post-translational modification...
  13. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Li Norepinephrine nLight red and green GPCR-based NE indicators Sensitive multicolor indicators for monitoring...Norepinephrine GRAB_NE family of GPCR activation-based NE sensors A Genetically Encoded Fluorescent Sensor ...fluorescent biosensors to measure biomolecules or genes via FRET or other assays. Plasmid...specific biomolecules, the activity of specific genes and cellular processes, or other factors like environmental...Campbell Calcium Ratiometric calcium biosensors from nested reporters of green- and orange-emitting proteins...proteins Ratiometric Matryoshka biosensors from a nested cassette of green- and orange-emitting fluorescent...mScarlet-based calcium sensor with exceptional brightness, photostability, and multiplexing capabilities...
  14. Validated gRNA Sequences

    Type
    Collection
    ...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut S. pyogenes 23287722... cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017... 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes 25337876 Ventura...cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S. pyogenes 26541286...
  15. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein...elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock..., cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA 47108...none S. pyogenes Gersbach pUC57-sgRNA expression vector 51132 Mammalian BsaI none S. pyogenes Huang pAC154... yes, activate S. pyogenes Jaenisch pSQT1313 53370 Mammalian BsmBI none S. pyogenes Joung PX461 (3rd Gen...
  16. CRISPR Plasmids - Plants

    Type
    Collection
    ... aU6 BsaI none S. pyogenes Kamoun 52255 pUC119-gRNA U6 PCR template none S. pyogenes Sheen 51295 pRGEB31...snoRNA U3 BsaI none S. pyogenes Yang 50579 pBUN6A11 OsU3 BsaI yes, activate S. pyogenes Bar Chen 50580 pBUN6I11...yes, interfere S. pyogenes Bar Chen 50582 pBUN501 AtU6-26 BsaI yes, nick S. pyogenes Bar Chen 50594 pCBC-MT2T3... paper BsaI none S. pyogenes Chen 50595 pCBC-MT3T4 see paper BsaI none S. pyogenes Chen 62204 pBUN421 ...TaU3 BsaI yes, cut S. pyogenes Bar Chen 53063 pU3-gRNA OsU3 AarI none S. pyogenes Gao 53061 pZmU3-gRNA ...gRNA maize U3 none S. pyogenes Gao 53062 pU6-gRNA wheat U6 BbsI none S. pyogenes Gao 59188 pBlu/gRNA Arabidopsis...Arabidopsis U6 BbsI none S. pyogenes Stupar 62200 pBUE411 OsU3 yes, cut S. pyogenes Basta Chen 62203 pHUE411...
  17. CRISPR Guide

    Type
    Collection
    ...repress, visualize, and isolate genes. Activation or Repression of Target Genes Figure 9: Overview of CRISPRi... and a user-defined ∼20-nucleotide spacer that defines the genomic target to be modified. You can therefore...CRISPR was originally employed to knock out target genes in various cell types and organisms, but modifications... ability to selectively activate/repress target genes, purify specific regions of DNA, image DNA in live...Multiplexing applications include editing multiple genes at once; using dual nickases to generate a knockout... used to knock out, activate, or repress target genes when paired with the appropriate Cas enzyme. Specific...CRISPR specificity. SpCas9 (from Streptococcus pyogenes ) is the most popular Cas endonuclease, with many...
  18. Lentiviral Prep Service

    Type
    Collection
    ...Screening Use pooled CRISPR libraries to screen for genes involved in specific biological processes. For more... Plasmid Pooled Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled libraries...library in backbone lentiGuide-Puro targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...SpCas9. 76,441 unique sgRNAs targeting 19,114 human genes along with 1000 non-targeting controls Puromycin...library in backbone lentiCRISPRv2 targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...and 76,441 unique sgRNAs targeting 19,114 human genes along with 1000 non-targeting controls Puromycin... in backbone XPR_502 (P65 HSF) targeting 18,885 genes and containing 56,762 unique sgRNAs. This backbone...
  19. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...AAV-EF1a-BbTagBY Control Joshua Sanes AV-9-PV2454 45186-AAV9 AAV-EF1a-BbChT Control Joshua Sanes AV-9-PV2629 100043...Looger, Eric Schreiter AV-1-PV3844 100855-AAV1 pAAV.CAG.Flex.NES-jRGECO1b.WPRE.SV40 Biosensor GENIE, Douglas...Douglas Kim AV-1-PV3845 100856-AAV1 pAAV.Syn.Flex.NES-jRGECO1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1...-1-PV3846 100857-AAV1 pAAV.Syn.NES-jRGECO1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3847 100852-...100852-AAV1 pAAV.CAG.Flex.NES-jRGECO1a.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3848 100853-AAV1 pAAV....Biosensor GENIE, Douglas Kim AV-1-PV3849 100854-AAV1 pAAV.Syn.NES-jRGECO1a.WPRE.SV40 Biosensor GENIE, Douglas ...Douglas Kim AV-1-PV3850 100849-AAV1 pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV3851...
  20. Luciferase Plasmid Collection

    Type
    Collection
    ...Double‐Readout Lu minescence‐based T wo‐ Hy brid) : Combines in vivo BRET with ex vivo luminescence-based co-immunoprecipitation...Luciferase Blog: Luminescent Imaging with Nano-lanterns Collection Highlights Empty Backbones Expression Constructs... DULIP ( DU al L uminescence-based C o- I mmunoprecipitation) plasmids : Luminescence-based protein-protein...for assays of transcriptional regulation and bioluminescent reporters. Plasmid...Luciferase is the enzyme responsible for the bioluminescence found in a diverse number of organisms, ranging...delivered intracellularly in order to measure luminescence. Gaussia luciferase is secreted and more stable...time course experiments possible, but its short luminescence half-life makes it too dim for many experimental...
Showing: 1 - 20 of 104 results