Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 14 results for: SAB

Showing: 1 - 14 of 14 results

  1. Validated gRNA Sequences

    Type
    Collection
    ...24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758 Sabatini AAVS1 H...26472758 Sabatini C16orf80 H. sapiens TGTCTGAGAAGTAAACCCGT 70651 cut S. pyogenes 26472758 Sabatini C3orf17...26472758 Sabatini C3orf17 H. sapiens GTGTGAGAATCCCTAAGGCG 70652 cut S. pyogenes 26472758 Sabatini C9orf114...26472758 Sabatini C9orf114 H. sapiens GCGGCAGAGAAGGAGGACCG 70655 cut S. pyogenes 26472758 Sabatini CAN1 S...26472758 Sabatini DDX3Y H. sapiens TCTTGTTGGGGCTAAAACCA 70657 cut S. pyogenes 26472758 Sabatini DNMT3A ...GAGGCATATTCTTCTCCTGG 70660 cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019...GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes 26472758 Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut...

  2. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...M. tuberculosis M. smegmatis Green monkey ( C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus (KSHV...genome-wide library Discontinued Knockout Human Sabatini and Lander 3rd 10 178,896 Activity-optimized genome-wide... genome-wide library 1000000100 Knockout Human Sabatini and Lander 3rd 10 187,535 Advanced Catalogue of...ribosomal, cell cycle) 51043 — 51048 Knockout Human Sabatini and Lander 3rd 10 Varies FNLCR CRISPRa Cell Surface...Human CRISPR Knockout Library 92352 Knockout Human Sabatini and Lander 3rd 50 6,661 Garnett Lab MinLibCas9...Garnett 3rd 2 37,722 Green monkey (Chlorocebus sabaeus) sgRNA library 178284 Knockout Green Monkey Doench...Metabolic Gene Knockout Library 110066 Knockout Human Sabatini 3rd 10 30,290 Human DNA Binding Domain-Focused...

  3. mTOR Pathway

    Type
    Collection
    ...this page was generated with the help of David Sabatini . mTOR Pathway Color is used for clarity and does...this page was generated with the help of David Sabatini . Return to top mTOR Pathway - Gene List Click...Return to top Resources Cancer Pathway ORF Kit (Sabatini & Wood) Tackling Cancers’ Drug Resistance with...with a New Screening Kit (from David Sabatini & Kris Wood) References mTOR signaling in growth control and... and disease. Laplante M, Sabatini DM. Cell. 2012 Apr 13;149(2):274-93. doi: 10.1016/j.cell.2012.03.017...

  4. Cancer Research Plasmids and Resources

    Type
    Collection
    ...Cancer Pathways ORFs Kit : Set of vectors from the Sabatini & Wood Labs containing cDNAs for studying oncogenic...Drug Resistance with a New Screening Kit (David Sabatini & Kris Wood) National Cancer Institute (NCI) NCI...

  5. Lentivirus Plasmids

    Type
    Collection
    ...can be used for cDNA expression; puro resistance Sabatini 14883 FUGW 3rd hUbC-driven EGFP; can be used for...EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895 pLX301 3rd Gateway plasmid for CMV driven...

  6. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ... Brightness pKa Maturation Structure Plasmids mKusabira-Orange (mKO) 548 559 31 5 4.5 hr Monomer pQC mKorange... mKorange IX - Mammalian Expression mKusabira Orange-C1 (mKO) - Mammalian Expression mKO-pBAD - Bacterial...

  7. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Mammalian/Lentiviral See paper none S. pyogenes Blast Sabatini and Lander lentiCRISPR v2 52961 Mammalian/Lentiviral...Mammalian/Lentiviral hU6 none S. pyogenes Puro Sabatini sgBbsI (p2Tol-U6-2xBbsI-sgRNA-HygR) 71485 Mammalian...

  8. CRISPR Guide

    Type
    Collection
    ...them referred to as INTEGRATE ( I nsertion of T ransposable E lements by G uide R NA- A ssisted T argeting... 661–667. PMID: 25961408 Wang, T., Wei, J. J., Sabatini, D. M., & Lander, E. S. (2014). Genetic screens...Livny, J., Regev, A., Koonin, E. V., Hung, D. T., Sabeti, P. C., Collins, J. J., & Zhang, F. (2017). Nucleic...

  11. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Venkataraju K, Straub C, Wang W, Robertson K, Osten P, Sabatini BL. 2019. Distinct Cortical-Thalamic-Striatal ...

  14. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...MJFF 38243 pLJM60-Tia1 TIA1 Flag CMV ALS David Sabatini 38248 pMXs-IP HA-Parkin PRKN HA Parkinson's Noboru...72873 PMXS-SLC1A3 SLC1A3 Episodic ataxia David Sabatini 74156 pCDNA3 HA C9ORF72 op C9orf72 HA CMV ALS ...
Showing: 1 - 14 of 14 results