We narrowed to 39 results for: SHA
-
TypeCollection...EB1 GFP Robin Shaw 40908 pDEST/LIfeAct-mCherry-N1 Actin Filaments LifeAct mCherry Robin Shaw 21948 pCAG-...Vladislav Verkhusha 31949 pPAmCherry-b-actin Actin Filaments beta-actin PAmCherry Vladislav Verkhusha 79990...Vladislav Verkhusha 79991 pmiRFP703-Tubulin Microtubules alpha-tubulin miRFP703 Vladislav Verkhusha 79993 ...miRFP703 Vladislav Verkhusha 79994 pEB3-miRFP703 Microtubules EB3 miRFP703 Vladislav Verkhusha 79996 pVimentin-miRFP703...Vladislav Verkhusha 79999 pZyxin-miRFP703 Focal Adhesions Zyxin miRFP703 Vladislav Verkhusha 55023 mCherry-Cx43...Robin Shaw 49861 pDEST-mCherry-GJA1-20k-N1 Gap Junctions Connexin 43 / GJA1-20k mCherry Robin Shaw 69007...pMito-miRFP703 Mitochondria COX8A miRFP703 Vladislav Verkhusha 36208 pmTurquoise2-Mito Mitochondria COX8A(1-29...
-
Trimmer Lab NeuroMab Collection
TypeCollection...Rat Mouse IgG2a 188222 Anti-Shank1 and Shank3 [N367/51R] Shank1 and Shank3 Rat Mouse IgG2a 188223 Anti-Synaptotagmin...Mouse IgG2a 222158 Shank1 [N22/18R] Shank1 Rat Mouse IgG2a 222159 Shank2 [N23B/9R] Shank2 Rat Mouse IgG2a...206727 Shank3 scFv [N69/46] N69/46 scFv Shank3 scaffold protein Rat Mouse 206728 Shank1 and Shank3 scFv ...Mouse 190542 Pan-Shank scFv [N23B/49] N23B/49 scFv Pan-Shank Rat Mouse 190543 Shank2 scFv [N23B/6] N23B...LRRTM4 Human Mouse IgG2a 128637 Anti-Pan-Shank [N23B/49R] Pan-Shank Mouse IgG2a 128638 Anti-VGlut1 [N28/9R...] ZNF423 Human Mouse IgG2a 140078 Anti-Shank3 [N69/46R] Shank3 Rat Mouse IgG2a 140079 Anti-GIT2 [N83/48R...RBM17/SPF45 Human Mouse IgG2a 177516 Anti-Shank1 [N22/21R] Shank1 Rat Mouse IgG2a 177517 Anti-TrpV1 [N221... -
Neurodegeneration Plasmid Collection
TypeCollection...TARDBP GFP CMV ALS Zuoshang Xu 28196 tdp43-EGFP construct3 TARDBP GFP CMV ALS Zuoshang Xu 28197 tdp43-EGFP...TARDBP GFP CMV ALS Zuoshang Xu 28198 tdp43-EGFP construct5 TARDBP GFP CMV ALS Zuoshang Xu 28199 tdp43-EGFP...TARDBP GFP CMV ALS Zuoshang Xu 28200 tdp43-EGFP construct7 TARDBP GFP CMV ALS Zuoshang Xu 28201 tdp43-EGFP...TARDBP GFP CMV ALS Zuoshang Xu 28202 tdp43-EGFP construct9 TARDBP GFP CMV ALS Zuoshang Xu 28203 tdp43-EGFP...TARDBP GFP CMV ALS Zuoshang Xu 28204 tdp43-EGFP construct11 TARDBP GFP CMV ALS Zuoshang Xu 28205 wtTDP43tdTOMATOHA...TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 NOTAG1 TARDBP CAG ALS Zuoshang Xu 28207 TDP43 NOTAG2 TARDBP... TARDBP CAG ALS Zuoshang Xu 28208 TDP43 NOTAG3 TARDBP CAG ALS Zuoshang Xu 28209 TDP43 NOTAG6 TARDBP CAG... -
AAV for Neuronal Tracing
TypeCollection...deletion-mutant rabies virus AAV1 Wickersham 100799 pAAV-TREtight-mTagBFP2-B19G AAV1 Wickersham Introduction to Rabies...required for transynnaptic spread (Wickersham et al., 2007a, Wickersham et al., 2007b). Thus, G-deleted ... complement deletion-mutant rabies virus AAV1 Wickersham 100798 pAAV-syn-FLEX-splitTVA-EGFP-tTA These ... Blog: Rabies and Neuronal Tracing References Wickersham IR, Finke S, Conzelmann KK, Callaway EM. 2007a...virus. Nat Methods. 4(1):47-9. PMID: 17179932 Wickersham IR, Lyon DC, Barnard RJ, Mori T, Finke S, Conzelmann... -
AAV Packaged on Request
TypeCollection...location. Share Your Results Once you start getting results from your AAV experiments, remember to share your...AAV Packaged on Request Overview Details Ordering Share Your Results Eligible Plasmids Additional Resources...Hub captures valuable knowledge that often goes unshared, bridging the gap between published methods and... We have distributed preps around the globe and shared our well-developed and trusted protocols and peer-reviewed...Access Addgene’s Data Hub for protocols and results shared by other scientists using AAV vectors. Our community-driven...published data, capturing the insights that often go unshared. Help Center Check out Addgene’s Help Center, ... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...serotypes were developed in Arun Srivastava’s or Shannon Boye’s lab at the University of Florida. References.... The AAV2(4pMut)dHS serotype was developed by Shannon Boye’s lab. It is derived from AAV2 and has the...identified by John Chiorini and characterized by Shannon Boye’s lab. AAV44.9(E531D) The AAV44.9(E531D) serotype...parental AAV44.9 serotype. It was developed by Shannon Boye’s lab. Plasmid Information The plasmid below...serotype in future publications, please acknowledge Shannon Boye and cite Boye, et al. 2016. Impact of Heparan...publications, please acknowledge John Chiorini and Shannon Boye and cite Boye, et al. 2020. Novel AAV44.9-...serotype in future publications, please acknowledge Shannon Boye and cite Boye, et al. 2020. Novel AAV44.9-... -
Bacterial Expression Systems
TypeCollection... FRET Robert Campbell Michael Davidson , Nathan Shaner , Roger Tsien 54553 54723 mTFP1-pBAD mCitrine-pBAD...Campbell , Michael Davidson Michael Davidson , Nathan Shaner , Roger Tsien 54575 54771 Clover-pBAD mRuby2-pBAD...BAD K-GAFm iRFP (reconstructed) BiFC Vladislav Verkhusha 52732 52733 pET11a-link-NGFP pMRBAD-link-CGFP ...gene, ARG1) Escherichia coli Nissle 1917 Mikhail Shapiro 106473 pET28a_T7-ARG1 Bacterial cells Ultrasound... reporter gene, ARG1) Escherichia coli Mikhail Shapiro 106474 pET28a_T7-ARG2 Bacterial cells Ultrasound... reporter gene, ARG2) Escherichia coli Mikhail Shapiro 192473 pBAD-bARGSer-AxeTxe Bacterial cells Ultrasound...reporter gene, Serratia ARG) Escherichia coli Mikhail Shapiro 78565 pCM18 Promoter activity Luminescence (lux... -
Validated gRNA Sequences
TypeCollection...26816379 Shaw AMPK alpha 1 H. sapiens GAAGATCGGCCACTACATTC 74375 nick S. pyogenes 26816379 Shaw AMPK alpha...26816379 Shaw AMPK alpha 2 H. sapiens GAAGATCGGACACTACGTGC 74377 nick S. pyogenes 26816379 Shaw ACTB H....pyogenes 26944679 Shaw Prkaa2 M. musculus ACAGGCATATGGTTGTCCAT 79005 cut S. pyogenes 26944679 Shaw Tfeb M. musculus...AGCACTGTTGCCGGCCGAGG 79006 cut S. pyogenes 26944679 Shaw Please refer to the primary article to confirm details... -
CRISPR History and Development for Genome Engineering
TypeCollection...Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang F. 2015. In vivo genome...classification defines 5 types and 16 subtypes based on shared characteristics and evolutionary similarity. These...27088723 Makarova KS, Wolf YI, Alkhnbashi OS, Costa F, Shah SA, Saunders SJ, Barrangou R, Brouns SJ, Charpentier...Zhang Y, Garcia B, Hidalgo-Reyes Y, Lee J, Edraki A, Shah M, Sontheimer EJ, Maxwell KL, Davidson AR. 2016....proteins. Genome Res . 25(10):1581-9. PMID: 26355004 Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson... -
Zhang Lab CRISPR Page
TypeCollection...Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang F. Nature . 2015 Apr..., Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, Cradick TJ, Marraffini LA, Bao G, Zhang F. Nat... CRISPR-Cas9 knockout screening in human cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods . 2014 Aug;11(8):783-4....Langer 9, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi... -
CRISPR Guide
TypeCollection..., A. J., Zetsche, B., Shalem, O., Wu, X., Makarova, K. S., Koonin, E. V., Sharp, P. A., & Zhang, F. (2015...cleave a given locus if the gRNA spacer sequence shares sufficient homology with the target DNA. Once the... S., Agarwala, V., Li, Y., Fine, E. J., Wu, X., Shalem, O., Cradick, T. J., Marraffini, L. A., Bao, G..... S., Wolf, Y. I., Alkhnbashi, O. S., Costa, F., Shah, S. A., Saunders, S. J., Barrangou, R., Brouns, ...Garcia, B., Hidalgo-Reyes, Y., Lee, J., Edraki, A., Shah, M., Sontheimer, E. J., Maxwell, K. L., & Davidson... (18), 3983-4002.e26. PMID: 37657419 Eid, A., Alshareef, S., & Mahfouz, M. M. (2018). CRISPR base editors...Communications . 9 (11), e1007749. PMID: 30575746 Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott... -
Michael J Fox Foundation (MJFF) Plasmid Collection
TypeCollection...top MJFF Shared Research Tools Labs affiliated with MJFF have also generated a number of Shared Research...Parkinson's Disease Plasmid Resource MJFF Plasmids Shared Research Tools (Link opens in a new window) The... window) encourages researchers to assemble and share tools for Parkinson's Disease research. This collection... -
Rett Syndrome
TypeCollection...Editing CRISPR-based DNA methylation editing system - Shawn Liu and Rudolf Jaenisch labs Plasmids MECP2 Plasmids...opens in a new window) Protocols.io - protocol sharing site Funding Opportunities (Link opens in a new...Neuropsychiatr Genet . 180, 55–67. PMID: 30536762 Shahbazian et al. 2002. Insight into Rett syndrome: MeCP2... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...., Gore, B. B., Weed, N., Omstead, V., Bishaw, Y., Shapovalova, N. V., Martinez, R. A., Fong, O., Yao,...Lerma, M. N., Taskin, N., Weed, N., Laird, W. D., Bishaw, Y. M., Bendrick, J. L., Gore, B. B., Ben-Simon... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Arizona Shaner et al. : Journal of Cell Science, Vol. 120, December 2007, pp. 4247-4260 Shaner et al. ...Fluorescently tag your gene for lentiviral expression Verkhusha Lab Plasmids - Enhanced colors, including PSmOrange... -
Impact of Genomic Variation on Function (IGVF) Consortium Collection
TypeCollection...predict, characterize, and map how genome function shapes phenotype, and how these processes are affected... variation on genome function and phenotype and shares their plasmid tools through Addgene. ID Plasmid... -
KLF Research Plasmids
TypeCollection... more about the scientists who have created and shared these plasmids....community have lead to the establishment of this shared resource on Addgene. If you have created plasmids... -
Synthetic Biology - Overview
TypeCollection... to facilitate the sharing of parts and information. Addgene can help you to share your synthetic biology... -
Control AAV Preps
TypeCollection...59331 pAAV-CAG-FLEX-EGFP CAG EGFP Cre dependent 1 Wickersham 104052 pAAV-CAG-DIO-EYFP CAG EYFP Cre dependent...pAAV.synP.DIO.EGFP.WPRE.hGH Syn EGFP Cre dependent 9 Wickersham 137130 pAAV-Ef1a-Con/Foff 2.0-BFP EF1a BFP Cre... -
Brain Initiative Collection
TypeCollection...coinjected with pAAV-TREtight-mTagBFP2-B19G Ian Wickersham 100799-AAV1 pAAV-TREtight-mTagBFP2-B19G helper...coinjected with pAAV-syn-FLEX-splitTVA-EGFP-tTA Ian Wickersham 104052-AAVPHP.V1 pAAV-CAG-DIO-EYFP An AAV genome...