Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 41 results for: control GFP

Showing: 1 - 20 of 41 results

  1. Caltech Systemic Capsids

    Type
    Collection
    ...pAAV-CAG-GFP CAG GFP Control Boyden 50465 pAAV-hSyn-EGFP hSyn EGFP Control Roth 50469 pAAV-CaMKIIa-EGFP CamKIIa... 135631 pAAV-S5E2-GFP-fGFP E2 regulatory element GFP, membrane-targeted GFP Control Dimidschstein 192552...pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP Control Gradinaru 105530 pAAV.CMV.PI....CamKIIa EGFP Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 83900 pAAV-mDlx-GFP-Fishell...pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 99130 pAAV-mDlx-NLS-mRuby2 Dlx mRuby2 Control Gradinaru 104055 pAAV-CAG-...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden MaCPNS2 These viral vector preparations...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B10 These viral vector preparations...

  2. Brain Initiative Collection

    Type
    Collection
    ...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV1 pAAV-mDlx-GFP-Fishell-1 GFP expression...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV2 pAAV-mDlx-GFP-Fishell-1 GFP expression...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV5 pAAV-mDlx-GFP-Fishell-1 GFP expression...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV8 pAAV-mDlx-GFP-Fishell-1 GFP expression...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV9 pAAV-mDlx-GFP-Fishell-1 GFP expression... the control of the mDlx enhancer element Gordon Fishell 83900-AAVrg pAAV-mDlx-GFP-Fishell-1 GFP expression... the control of the mDlx enhancer element Gordon Fishell 83900-PHPeB pAAV-mDlx-GFP-Fishell-1 GFP expression...

  3. Retrograde AAV viral preps

    Type
    Collection
    ...pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Control Fishell...AAV-CAG-GFP CAG GFP Control Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control Zeng 50465...50465 pAAV-hSyn-EGFP Syn EGFP Control Roth 50469 pAAV-CaMKIIa-EGFP CamKII EGFP Control Roth 114472 pAAV-hSyn-mCherry...Cre-dependent Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP Syn EGFP...pAAV-hSyn-mCherry Syn mCherry Control Deisseroth 114469 pAAV-CaMKIIa-mCherry CamKII mCherry Control Deisseroth 50459...Cre-dependent Control Roth 55650 pAAV-hSyn Con/Fon EYFP Syn EYFP, Cre and Flp-dependent Control Deisseroth... Cre-dependent Control Boyden 27056 pAAV-Ef1a-DIO EYFP EF1a EYFP, Cre-dependent Control Deisseroth 55641...

  4. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...pAAV.GfaABC1D.PI.Lck-GFP.SV40 Control Baljit Khakh AV-5-PV2380 100896-AAV5 pAAV.GFA104.PI.eGFP.WPRE.bGH Control Philip...pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-9-PV0101 105530-AAV9 pAAV.CMV.PI.EGFP.WPRE.bGH Control James ...pAAV-Ef1a-DIO EYFP Control Karl Deisseroth AV-1-ALL854 51502-AAV1 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng....SV40 Control Loren Looger AV-1-PV3661 98927-AAV1 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 Control Loren ...pAAV-Ef1a-DIO EYFP Control Karl Deisseroth AV-2-ALL854 51502-AAV2 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng...pAAV.CMV.LacZ.bGH Control James M. Wilson AV-5-PV1917 105541-AAV5 pENN.AAV.CamKII0.4.eGFP.WPRE.rBG Control James ...pENN.AAV.CMVs.TurboRFP.WPRE.RBG Control James M. Wilson AV-5-PV2213 105547-AAV5 pENN.AAV.EF1a.eGFP.WPRE.rBG Control James M. ...

  5. Control AAV Preps

    Type
    Collection
    ...Packaging Service AAV Controls Viral Vector Packaging Service: Control AAV Browse our control AAV that express...CAG-NLS-GFP CAG NLS-GFP Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive...Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive 1, 2, 5, 8, 9, rg*, PHPeB, CAP-B10...*, PHP.eB, PHP.S Boyden 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB ...dependent PHP.V1 Gradinaru 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Fishell 83894...PHP.eB Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory EGFP Constitutive 1, 9, PHP.eB Dimidschstein... 9 Wilson 105598 pAAV.GfaABC1D.PI.Lck-GFP.SV40 GfaABC1D Lck-GFP Constitutive 5 Khakh 105622 pAAV.CamKII...

  6. Viral Production

    Type
    Collection
    ...Production Titer Quality Control Resources Lentivirus Production Titer Quality Control Resources Overview of... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...subunit (RPP30) as a control for normalization purposes are being used. Quality Control Mycoplasma The 293T...Addgene's viral production methods and quality control for lentivirus and AAV. Viral...virus preps are titered and subjected to quality control by Addgene before being distributed to customers...production protocols, titering methods, and quality control are described below. AAV Production AAV distributed...probes targeting the ITR elements and an internal control of known titer (protocol modified from Lock et ...

  7. Lentiviral Prep Service

    Type
    Collection
    ...Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV... 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 ...library expresses EGFP for easy visualization via direct fluorescence. Morris Control Lentivirus Browse...CRISPR Libraries Cas9 Pooled Barcoding Libraries Control Addgene's lentiviruses are made from plasmids that...76,441 unique sgRNAs along with 1000 non-targeting controls. This backbone does not contain SpCas9. 76,441...,114 human genes along with 1000 non-targeting controls Puromycin Doench , Root 73179 Human gRNA pooled...76,441 unique sgRNAs along with 1000 non-targeting controls. This backbone contains SpCas9. SpCas9 and 76,...

  8. Bacterial Expression Systems

    Type
    Collection
    ...many different restriction enzymes. pPro24-gfp contains GFP but all others are empty. pdCas9-bacteria ...Engineering Visualization and Tagging Purification Controlled Expression Reporter Plasmids Reporter Plasmids...Plasmids Tagging and Visualization Purification Controlled Expression Reporter Plasmids You may also like… ...Manipulating the genome directly can give you more subtle control over protein expression and activity thereby limiting...fluorophore-tagged MS2 (such as that found in pZS*12-MS2-GFP ) to track RNA localization of your gene of interest...protein’s function under a wide range of highly controlled conditions in vitro , or, if you want to determine...

  9. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...pSNAPf-Cox8A Control Plasmid SNAP-tag Control for mitochondrial localization 101124 pSNAPf-H2B Control Plasmid...SNAP-tag Control for nuclear localization 101123 pSNAPf-ADRβ2 Control Plasmid SNAP-tag Control for cell...pCLIPf-H2B Control Plasmid CLIP-tag Control for nuclear localization 101130 pCLIPf-Cox8A Control Plasmid ...CLIP-tag Control for mitochondrial localization 101125 pCLIPf-NK1R Control Plasmid CLIP-tag Control for cell...pMCP-GPI Control Plasmid ACP/MCP-tag Control for cell surface localization 101131 pACP-GPI Control Plasmid...-tag Control for cell surface localization 101128 pACP-ADRβ2 Control Plasmid ACP/MCP-tag Control for cell...comprehensive comparison to GFP, please refer to NEB's comparison of SNAP-tag, CLIP-tag, and GFP . Technology SNAP-tag...

  10. Cre-lox system

    Type
    Collection
    ...48201 CAG-GFP-IRES-CRE Cre and GFP coexpression CAG Retroviral Gage 49054 CAG-GFP/cre Cre-GFP fusion CAG...116879 CAG-Cremyc-2A-GFP GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc-2A-GFP GFP and Cre CMV Lentiviral...iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, and GFP TRE Mammalian Jacks 68544 AAV-Cre-GFP Cre CMV AAV Nestler...13770 pCALNL-GFP Cre dependent GFP expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch...promoterless CRE-GFP fusion none Mammalian Sauer 11960 pBS537 tet-hCMV-GFPcre tet inducible Cre-GFP fusion tet-hCMV... CMV Lentiviral Fuchs 26646 pCAG-Cre-IRES2-GFP Cre and GFP coexpression CAG Mammalian Chenn 26647 pCAG-Cre...CAG Retroviral Gage 49056 AAV-GFP/Cre Cre-GFP fusion CMV AAV Gage 49111 pEMS1980 iCre with MCS for inserting...

  11. Serotype Testing AAV

    Type
    Collection
    ... AAV available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing...list of all 100 µL sized sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information... catalog item, including the titer and quality control, visit the material page (linked for each catalog... 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...

  12. Fluorescent Protein Guide: Activity Regulation

    Type
    Collection
    ...Plasmids GFP GFP-dependent transcription factors Connie Cepko See Plasmids Dronpa Optical control of protein...Optogenetics Background Fluorescent proteins such as GFP have long been used for labeling, but new methods...regulate a variety of other activities. By using GFP as a scaffold, scientists can design de novo systems...modular components or take advantage of existing GFP-lines for cell-specific manipulation. Plasmids Fluorescent...

  13. Optogenetics AAV Preps

    Type
    Collection
    ...soCoChR-GFP Syn CoChR (soma-targeted) GFP Constitutive 9 Boyden 107712 pAAV-hSynapsin-FLEX-soCoChR-GFP Syn...pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Jaws GFP Constitutive 5, 8, rg* Boyden 84445 pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] CAG...* Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn ChR2/H134R GFP Constitutive 8, rg* Boyden 100054 pAAV....Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Boyden 59171 pAAV-...Constitutive 8 Deisseroth 22222 AAV-FLEX-Arch-GFP CAG Arch GFP Cre dependent 1, 9 Boyden 28305 pAAV-FLEX-...dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CaMKII ArchT GFP Constitutive 1, 5, 9, rg* Boyden 137148...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...

  14. Antibody Production

    Type
    Collection
    ... undergo stringent quality control by Addgene or a trusted quality control partner before distribution...Addgene's antibody production methods and quality control processes for purified recombinant antibodies. ...production protocols, titering methods, and quality control are described below. Information for a specific...samples with >90% purity are distributed. Quality Control Each lot of antibody undergoes testing, either ... not endogenously-expressed (e.g., using an anti-GFP antibody), the target antigen is first transiently...fluorescence pattern is compared to an untransfected control. Immunohistochemistry (IHC) Tissue sections are...Protein expression is compared to an untransfected control and the protein size is confirmed. Residual Plasmid...

  15. AAV Molecular Tools

    Type
    Collection
    ... These AAV encode tetracycline-inducible tools/controls and tetracycline transactivators that can be used...Cre-dependent Cre-dependent expression of membrane-bound GFP and synaptophysin-mRuby for labeling of axon terminals...System Activity Serotype PI 124364 pAAV-FLEX-DTR-GFP CBA-driven, Cre-dependent Cre-dependent expression...expression of diphtheria toxin receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a 5, rg* ...and synaptophysin-EGFP for labeling of axon terminals. 1 Zeng 71760 pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby...Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent expression...

  16. Luciferase Plasmid Collection

    Type
    Collection
    ...Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP James Wilson...pKC-4.06 : Nonsense-mediated decay reporter and control plasmid utilizing Firefly luciferase. Transcriptional...luciferase gene fusions. Renilla luciferase under the control of a CMV promoter is present for normalization ...Vector Firefly Vector for investigating regions controlling transcription Debrya Groskreutz 60323 pGL4.23...fusions in plants. Renilla luciferase under the control of a CMV promoter is present for normalization ...luciferase. Firefly luciferase expression under the control of a HSV TK promoter for normalization Ting Ni ...luciferase. Firefly luciferase expression under the control of a HSV TK promoter for normalization. Modified...

  18. Tetracycline Inducible Expression

    Type
    Collection
    ...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS... for Tet-controlled expression (On or Off) None Tight TRE Markus Ralser 64238 pTet-IRES-EGFP Lentiviral...Lentiviral plasmid for Tet-controlled expression of transgene of interest with EGFP (On or Off) None TRE, miniCMV...and repressible promoters are powerful tools to control gene expression and study biological targets. The...popular choices for rapid, efficient, and reversible control of gene expression in eukaryotes. To avoid secondary... While TetR and tet O could be a basic tool to control gene expression, the system has been engineered...

  19. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...

  20. Bikard Lab - CRISPR Repression Collection

    Type
    Collection
    ... the two reporters, mCherry and sfgfp in this case, can be controlled using a plasmid‐borne CRISPR array...target sequence lower the repression level. By controlling the number of mismatches we can obtain a range... the tracrRNA sequence (not shown). (B) Relative GFP and RFP concentration given relatively to the non‐targeting...carrying two CRISPR guides. The first one binds to sfgfp with either 0, 10, 11, 14, or 20 matching nucleotides...for these two reporters simultaneously. By fusing sfGFP and/or mCherry to genes of interest, it is thus ...
Showing: 1 - 20 of 41 results