Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 18 results for: luciferase

Showing: 1 - 18 of 18 results

  1. Luciferase Plasmid Collection

    Type
    Collection
    ... of luciferase found in Addgene's collection include: Firefly luciferase (Fluc) Renilla luciferase (Rluc...respectively), Cypridina luciferase , and Luciola luciferase . Each type of luciferase has advantages and disadvantages...CMV Dual secreted luciferase reporter (EF1α-Gaussia luciferase, CMV-Cypridina luciferase). Feng Zhang Return... Plasmid Collections Luciferase Plasmids Luciferase Plasmid Collection Empty Backbones Expression...Fluorescent Proteins Blog: Luciferase 101 Blog: Technologies Enabled by NanoLuc® Luciferase Blog: Luminescent ...Gaussia luciferase (Gluc) NanoLuc® (Nluc) The mammalian codon-optimized version of firefly luciferase is often...Luc2. Other luciferases in our collection include the red and green Click-beetle luciferases ( CBRluc and...

  2. Promega Plasmid Collection

    Type
    Collection
    ...HaloTag, SmBiT, LgBiT, HiBiT, and more. Luciferase Reporters Luciferase (Link opens in a new window) reporter...NanoLuc luciferase-fusion protein expressed in cells. Additional Resources Browse Addgene's Luciferase Plasmid...Find luciferase reporter vectors for sensitive gene expression analysis and fusion vectors containing...experimental workflows. The collection contains luciferase reporter vectors for sensitive gene expression..., reporter, protein, or tag, such as "NFAT", "luciferase", "Ras", "NanoLuc", "HaloTag", "BiT", or other... 19.1 kDa and exceptionally bright and stable luciferase that enables highly sensitive detection at endogenous...living cells. NanoBRET PPI assays use NanoLuc Luciferase as a BRET energy donor and HaloTag protein, labeled...

  3. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...expressing firefly luciferase. pCMV-FLuc - Retroviral reporter vector expressing firefly luciferase. pHAGE-CMV-Luc2... vector expressing firefly luciferase and ZsGreen. NL4-3 mCherry Luciferase - Lentiviral dual reporter...EGFP. Lenti-luciferase-P2A-Neo - Lentiviral reporter vector expressing firefly luciferase with neomycin...reporter vector expressing mCherry and firefly luciferase. pLentiEGFPdestablized - EFS-EGFPd2PEST-2A-MCS-Hygro...

  4. Retrovirus Plasmids

    Type
    Collection
    ...18760 MSCV IRES Luciferase MSCV Plasmid for transgene expression; also expresses luciferase Lowe 9044 pMIG...Sun 60683 pLXIN-Luc MoMSV Stable expression of luciferase in mammalian cells Wong Return to Top Do you ...

  5. Zhang Lab CRISPR Page

    Type
    Collection
    ...to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA cloning backbone with luciferase-2A-Cre recombinase...sgRNAs targeting KRAS , p53 , and LKB1 , plus luciferase-2A-Cre recombinase, and Kras G12D HDR template...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and sgRNAs targeting the mouse...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA targeted to LacZ...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA backbone for ...

  6. Chemogenetics Plasmids

    Type
    Collection
    ...luminescent opsins: fusion proteins of a light-emitting luciferase and a light-sensing optogenetic element, making... bimodal opto-chemogenetic actuator. When the luciferase enzyme oxidizes its substrate (luciferin), it...

  7. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...TALEN array for genomic engineering Luciferase Reporter See our Luciferase collection of plasmid backbones... to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...target genes can be inserted into this firefly luciferase reporter to test for their effects on protein...

  8. Bacterial Expression Systems

    Type
    Collection
    ...transcription factors. Addgene Blog Luciferase Technologies Enabled by NanoLuc® Luciferase Fluorescent Biosensors ...easily measurable reporter genes (e.g., LacZ, luciferase, or fluorescent proteins) under the control of...FFluc Promoter activity Luminescence (firefly luciferase) Mycobacterium sp. Brian Robertson , Siouxsie...

  9. Fluorescent Protein Guide

    Type
    Collection
    ... Resources You May Also Like... Luminescence: Luciferase Plasmids Blog: Which FP Should I Use? Blog: How...

  10. Plasmid Collections

    Type
    Collection
    ...Zinc Fingers Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus...

  12. COVID-19 Resources

    Type
    Collection
    ...spike pseudotyped virus. It also lists several luciferase and fluorescent reporter plasmids that have been...

  14. Validated gRNA Sequences

    Type
    Collection
    ...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737...

  16. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214673 lucMAPT-30U MAPT T5, luciferase CMV Parkinson's...FTD Eugene Yeo 214674 lucMAPT-GenRep MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214814 U6_ ATM_G101...

  17. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...James M. Wilson AV-1-PV0105 105532-AAV1 pAAV.CMV.ffLuciferase.SV40 Control James M. Wilson AV-1-PV1917 105541...James M. Wilson AV-8-PV0105 105532-AAV8 pAAV.CMV.ffLuciferase.SV40 Control James M. Wilson AV-8-PV0146 105535...Karl Deisseroth AV-5-PV0105 105532-AAV5 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-5-PV1090 105537-AAV5... M. Wilson AV-8-PV1302 105538-AAV8 pENN.AAV.TBG.PI.ffLuciferase.RBG James M. Wilson AV-8-PV3637 65015-...Karl Deisseroth AV-9-PV0105 105532-AAV9 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-9-PV0109 105533-AAV9...Karl Deisseroth AV-2-PV0105 105532-AAV2 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-1-PV3365 105554-AAV1...

  18. Control AAV Preps

    Type
    Collection
    ...Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 8 Wilson 105534 ...
Showing: 1 - 18 of 18 results