Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 15 of 15 results

  1. Luciferase Plasmids

    Type
    Collection
    ...types of luciferase found in Addgene’s collection are Firefly luciferase (Fluc), Renilla luciferase (Rluc... Plasmid Collections Luciferase Plasmids Luciferase Plasmid Guide You may also like... Fluorescent...Fluorescent Proteins Blog: Luciferase 101 Blog: Technologies Enabled by NanoLuc® Luciferase Blog: Luminescent ...and NanoLuc® Luciferase (Nluc). Luc2 is the second-generation version of Firefly luciferase that has been...mammalian systems. Other luciferases in our collection include Gaussia luciferase (Gluc) and the red and...green Click-beetle luciferases (CBRluc and CBGluc, respectively). Like Firefly luciferase, Click-beetle red...type of luciferase has advantages and disadvantages depending on the application. Firefly luciferase is considerably...

  2. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...expressing firefly luciferase. pCMV-FLuc - Retroviral reporter vector expressing firefly luciferase. pHAGE-CMV-Luc2... vector expressing firefly luciferase and ZsGreen. NL4-3 mCherry Luciferase - Lentiviral dual reporter...EGFP. Lenti-luciferase-P2A-Neo - Lentiviral reporter vector expressing firefly luciferase with neomycin...reporter vector expressing mCherry and firefly luciferase. pLentiEGFPdestablized - EFS-EGFPd2PEST-2A-MCS-Hygro...

  3. Retrovirus Plasmids

    Type
    Collection
    ...18760 MSCV IRES Luciferase MSCV Plasmid for transgene expression; Also expresses luciferase Lowe 9044 pMIG...Sun 60683 pLXIN-Luc MoMSV Stable expression of luciferase in mammalian cells Wong Return to Top Do you ...

  4. Zhang Lab CRISPR Page

    Type
    Collection
    ...to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA cloning backbone with luciferase-2A-Cre recombinase...sgRNAs targeting KRAS , p53 , and LKB1 , plus luciferase-2A-Cre recombinase, and Kras G12D HDR template...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and sgRNAs targeting the mouse...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA targeted to LacZ...plasmid contains two expression cassettes, Renilla luciferase-2A-Cre recombinase and an sgRNA backbone for ...

  5. Bacterial Expression Systems

    Type
    Collection
    ...pTac GFP, Luciferase (LuxCDABE) Attila Karsi Broad host range vectors for expressing luciferase and fluorescent...Quorum sensing molecule) Cynthia Collins Contains luciferase inducible by the quorum sensing molecule, 3OC6HSL...promoter can be found in pCS-PesaRlux controlling luciferase expression. pCW-LIC 26098 3x Tac promoter (hybrid...

  6. Fluorescent Protein Guide

    Type
    Collection
    ... Resources You May Also Like... Luminescence: Luciferase Plasmids Blog: Which FP Should I Use? Blog: How...

  7. Plasmid Collections

    Type
    Collection
    ...Zinc Fingers Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus...

  8. Tetracycline Inducible Expression

    Type
    Collection
    ...single copy in mammalian cells; Expresses firefly luciferase hairpin and GFP under pTREtight promoter None...pSBtet-GP Sleeping Beauty transposon system; has luciferase in cloning site; see article for additional selection...

  9. Cre-lox system

    Type
    Collection
    ...backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Cre, luciferase, and sgRNA expression EFS AAV Zhang 60229 AAV...Retroviral Luikart 67503 pF CAG luc-EGFP-cre puro Luciferase - EGFP- Cre fusion CAG Mammalian Stringer 68448...12463 p231 pCMVe-betaAc-STOP-luc Cre dependent luciferase expression Mammalian Green 32145 pJFRC172-10XUAS-loxP...

  11. COVID-19 Resources

    Type
    Collection
    ...spike pseudotyped virus. It also lists several luciferase and fluorescent reporter plasmids that have been...

  12. Validated gRNA Sequences

    Type
    Collection
    ...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737...

  14. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...James M. Wilson AV-1-PV0105 105532-AAV1 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-1-PV1917 105541-AAV1...James M. Wilson AV-8-PV0105 105532-AAV8 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-8-PV0146 105535-AAV8...Karl Deisseroth AV-5-PV0105 105532-AAV5 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-5-PV1090 105537-AAV5... M. Wilson AV-8-PV1302 105538-AAV8 pENN.AAV.TBG.PI.ffLuciferase.RBG James M. Wilson AV-8-PV3637 65015-...Karl Deisseroth AV-9-PV0105 105532-AAV9 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-9-PV0109 105533-AAV9...Karl Deisseroth AV-2-PV0105 105532-AAV2 pAAV.CMV.ffLuciferase.SV40 James M. Wilson AV-1-PV3365 105554-AAV1...

  15. Control AAV Preps

    Type
    Collection
    ...Constitutive 1, 5, 8, 9 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 1, 8 Wilson 105536...
Showing: 1 - 15 of 15 results