We narrowed to 3 results for: luciferase

...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin...luciferin) is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...increased efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference...

...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ...

...These plasmids contain a reporter gene (e.g., luciferase or GFP) that offers a readout of the activity...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ...that promoter. Fluorescent Protein Plasmids , Luciferase Plasmids Viral Plasmids These plasmids are modified...