Skip to main content

We narrowed to 24 results for: mPA-GFP

Showing: 1 - 20 of 24 results
  1. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression mPA-Emerald 487 509 400 Monomer (A206K) mPA-Emerald-N1 - Mammalian Expression mPA-Emerald-C1...Mammalian Expression sfGFP (superfolder GFP) 485 507 54 14 min Prone to dimerization sfGFP-N1 - Mammalian Expression...Expression EGFP 488 507 34 6 25 min Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian...Expression PA-GFP 504 517 400 14 Monomer (A206K) pPAGFP-N1 - Mammalian Expression pPAGFP-C1 - Mammalian... pRSETA-PAGFP - Bacterial Expression pFA6a-PA-GFP-kanMX6 - Yeast Expression pFA6a-link-yEPAGFP-CaUra3 ...Brightness pKa Maturation Structure Plasmids Free Use GFP (fuGFP) 395 503 Monomer pUS252 - Mammalian Expression...high concentration. Proteins that are derived from GFP and contain the A206K mutation are monomeric at all...
  2. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... Gerlich 25999 LV-GFP Chromatin H2B GFP Elaine Fuchs 11680 H2B-GFP Chromatin H2B GFP Geoff Wahl 21210 ...61803 GFP-Rab7A Late endosomes Rab7a AcGFP Gia Voeltz 12605 GFP-rab7 WT Late endosomes RAB7 GFP Richard...Gadella 50057 pLYS1-FLAG-MitoGFP-HA Mitochondria MCU GFP Vamsi Mootha 49153 GFP-Mff Mitochondria-Outer ...89472 GFP-hChibby1 Mother Centrioles / Ciliary Base Chibby1 GFP Ken-Ichi Takemaru 89770 pLenti-EGFP-hChibby1...Filaments beta-actin EGFP Robert Singer 27382 pDEST/N1-hEB1-GFP Microtubules EB1 GFP Robin Shaw 40908 pDEST...Beta-catenin GFP Adherens Junctions Beta-catenin EGFP Alpha Yap 67937 mouse E-cadherin GFP (423) Adherens...38277 pMXs-puro GFP-p62 Autophagosome Sequestosome-1 EGFP Noboru Mizushima 38272 pMXs-IP GFP-WIPI-1 Autophagosome...
  3. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...Fluorescent proteins (GFP, mCherry, etc) Localization pcDNA3-EGFP - C-terminal GFP for mammalian expression...agroinfection-compatible Tobacco mosaic virus (TMV)-based transient expression vector GFP Varies pMKO.1 GFP - Retroviral...genome MSCV-IRES-GFP or pMSCV-IRES-mCherry FP - Mammalian retroviral gene expression with GFP or mCherry selectable...fusing your protein to another protein, such as GFP, which allows you to visualize the cellular localization... cells, integrate into host genome pLenti CMV GFP DEST - Lentiviral Gateway destination vector for ...PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1 GFP - Retroviral shRNA expression Retroviral backbones...stemloop 2 and EF1a-zeo resistance marker pLenti CMV/TO GFP-Zeo DEST (719-1) - 3rd gen lentiviral Gateway destination...
  4. Control AAV Preps

    Type
    Collection
    ...CAG-NLS-GFP CAG NLS-GFP Constitutive PHPeB Viviana Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive...Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive 1, 2, 5, 6, 8, 9, 11, rg*, PHPeB...PHP.eB, PHP.S Edward Boyden 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB ...Constitutive 1 Kiryl Piatkevich 214147 pAAV-hIBA1a-GFP-miR124T hIBA1a GFP Constitutive 5 Chun-Li Zhang 20299 pAAV-EF1a-double... Viviana Gradinaru 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Gordon Fishell..., 9, rg* Karl Deisseroth 122100 pAAV-EF1α1.1-GFP EF1a GFP Constitutive 2 Edward Boyden 128434 pAAV-Ef1a-fDIO-tdTomato...Jordane Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory EGFP Constitutive 1, 9, PHP.eB Jordane Dimidschstein...
  5. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... AAV-FLEX-Arch-GFP Optogenetics Ed Boyden AV-1-PV2527 99039-AAV1 pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics...pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics Ed Boyden AV-5-PV3446 59170-AAV5 pAAV-Syn-Chronos-GFP Optogenetics...pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics Ed Boyden AV-8-PV3638 65014-AAV8 pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics... AAV-FLEX-Arch-GFP Optogenetics Ed Boyden AV-9-PV2527 99039-AAV9 pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics...29777-AAV5 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV2509 29777-AAV9 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV3446 59170...59170-AAV9 pAAV-Syn-Chronos-GFP Ed Boyden AV-1-PV3511 98926-AAV1 pAAV.CAG.GFPsm-myc.WPRE.SV40 Loren Looger...Ed Boyden AV-1-PV3446 59170-AAV1 pAAV-Syn-Chronos-GFP Optogenetics Ed Boyden AV-1-PV3447 59171-AAV1 pAAV-Syn-ChrimsonR-tdT...
  6. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...Parkinson's, FTD Michael Davidson 57146 mPA-GFP-MAPTau-N-10 MAPT GFP CMV Parkinson's, FTD Michael Davidson...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...
  7. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...68299 GFP E17TAG/Q157TAG Plasmid 68298 GFP S2TAG/E17TAG Plasmid 68297 GFP Q157TAG Plasmid 68296 GFP S2TAG...Library 111704 Mode #1 Library Plasmid 69118 E17TAG GFP zeo resistance Plasmid 68307 SupD Strain 68306 C321...S2TAG Plasmid 68295 GFP E17TAG Plasmid 68294 SepOTSν Plasmid 68292 SepOTSλ Plasmid 68291 SepOTSκ Plasmid...pSerOTS-C1* (V70) is a ROP minus plasmid and is not compatible with other plasmids containing high copy ColE1...
  8. Viral Production

    Type
    Collection
    ... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...viral genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, ... prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from Edward Boyden (Addgene viral...Purity Purity of AAV preparations is assayed by comparing the relative stoichiometric ratios of the viral...
  9. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...
  10. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...comprehensive comparison to GFP, please refer to NEB's comparison of SNAP-tag, CLIP-tag, and GFP . Technology...internal or surface proteins Single constructs are compatible with multiple applications (different fluorophores...
  11. Serotype Testing AAV

    Type
    Collection
    ...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information... available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing...encode fluorescent reporters and can be used to compare the tropism of different serotypes. In addition... 37825-AAVrg.T 20 µL $ 150 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...
  12. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing... FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential patterning of cGMP... vascular smooth muscle cells revealed by single GFP-linked biosensors. Proc Natl Acad Sci U S A. 2008...autophagic flux by pH-sensitive fluorescence (pMRX-IP-GFP-LC3-RFP) An Autophagic Flux Probe that Releases an...
  13. Bacterial Expression Systems

    Type
    Collection
    ...Vladislav Verkhusha 52732 52733 pET11a-link-NGFP pMRBAD-link-CGFP GFP (reconstructed) BiFC Lynne Regan 168257...Fluorescence (GFP+) Gram-negative bacteria Philip Poole 14460 pOT2 Promoter activity Fluorescence (GFPuv) Gram-negative... Guide to Selecting Fluorescent Dyes and Ligands GFP Fusion Proteins — Making the Right Connection Photoactivatable...pRsetB-his7-Perceval ATP:ADP ratio Fluorescence (GFP) Escherichia coli Gary Yellen 187836 pVoPo-01 Promoter...bacteria Philip Poole 14083 pAKgfplux1 Promoter activity Fluorescence (GFPmut3a) and luminescence (lux operon...bacteria Attila Karsi 14076 pAKgfp1 Promoter activity Fluorescence (GFPmut3a) Gram-negative bacteria Attila...-M ATP Fluorescence (GFPmut2) Escherichia coli Rahul Sarpeshkar 111614 pCdrA-gfpC Cyclic di-GMP Fluorescence...
  14. Tetracycline Inducible Expression

    Type
    Collection
    ...Iwasato 63704 pRetroX GFP T2A Cre Retroviral vector for dox-inducible expression of GFP T2A Cre recombinase...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS...pTet-IRES-EGFP Lentiviral plasmid for Tet-controlled expression of transgene of interest with EGFP (On or...transactivators and promoters are generally cross-compatible. Your choice of transactivator, promoter, and...et al., 2016 (Link opens in a new window) for comparison of Tet-On systems in different applications. ... Off) None TRE, miniCMV Maria Lung 16542 pBI-MCS-EGFP Bidirectional promoter (Pbi) for Tet-responsive ...
  15. CRISPR Plasmids for Genomic Visualization

    Type
    Collection
    ...marker like GFP, researchers have turned dCas9 into a customizable DNA labeler compatible with fluorescence...detecting multiple genomic loci, and compatible with live cell imaging. Compared to techniques like fluorescence...
  16. Antibody Production

    Type
    Collection
    ... not endogenously-expressed (e.g., using an anti-GFP antibody), the target antigen is first transiently...containing 1 mM sodium azide. This buffer is not compatible for use in live cells and will interfere with...secondary antibody. The fluorescence pattern is compared to an untransfected control. Immunohistochemistry...secondary antibody. The tissue labeling pattern is compared to the mRNA expression pattern cited in the Tissue...HRP-conjugated secondary antibody. Protein expression is compared to an untransfected control and the protein size...
  17. Antibody Plasmid Collection

    Type
    Collection
    ...find antibody plasmids for: Common antigens such as GFP or mCherry Monoclonals, Nanobodies, Sybodies, or ...peptide, from the popular SunTag system, fused to sfGFP for imaging. Learn more about antibodies and their... and Evolving Functional Proteins. METHODS: A Companion to Methods in Enzymology 8, 94–103 (1995). Carlos...
  18. Biosensor AAV Preps

    Type
    Collection
    ...pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 CAG Archon1 EGFP Cre dependent 5 Boyden 115892 pAAV-Syn-Archon1-KGC-GFP-ER2 Syn Archon1...Archon1 EGFP Constitutive 8 Boyden 115893 pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] Syn Archon1 EGFP Cre dependent...Podgorski Calcium Sensor: CaMPARI 100831 pENN.AAV.CAG.Flex.CaMPARI.WPRE.SV40 CAG CaMPARI none Cre dependent ...pAAV_hsyn_NES-his-CaMPARI2-WPRE-SV40 Syn CaMPARI2 his Constitutive 1 Schreiter 101061 pAAV_hsyn_NES-his-CaMPARI2-F391W-WPRE-SV40...dependent 5 Looger 100832 pAAV.hSyn.CaMPARI.WPRE.SV40 Syn CaMPARI none Constitutive 1, 5, 9 Looger 101060 pAAV_hsyn_NES-his-CaMPARI2...F391W-WPRE-SV40 Syn CaMPARI2-F391W his Constitutive 1 Schreiter 101064 pAAV_hsyn_NES-his-CaMPARI2-L398T-WPRE-SV40...HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP Syn HaloCaMP1a EGFP Constitutive 1, 9 Schreiter Calcium Sensor...
  19. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ...157970 pTR-UF11 chimeric CMV/Chicken Beta actin (CBA) GFP Control Sergei Zolotukhin Citation Information AAV2...intravitreal injection in mice and marmosets as compared to the AAV2 serotype. The AAV2(Y444F) serotype...in the retina following subretinal injection as compared to the parental AAV44.9 serotype. It was developed...acknowledge Shannon Boye and cite Boye, et al. 2016. Impact of Heparan Sulfate Binding on Transduction of Retina...
  20. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...DOG New Tricks: Controlling Protein Activity with GFP Plasmids 101: FLEx Vectors Optimizing AAV DIO and... exchange (RMCE): When matching but mutually incompatible recognition sites flank both a DNA target site...
Showing: 1 - 20 of 24 results