We narrowed to 30 results for: tet on
-
TypeCollection... of tet-responsive systems: Tet-Off and Tet-On. Read on to learn more about the components of tet systems... center: Tet-Off; right: Tet-On. TRE: Tet response element; tTA: tetracycline-controlled transactivator... Plasmid Collections Tetracycline (Tet) Inducible Expression Tetracycline (Tet) Inducible Expression ...shown. Tetracycline Off (Tet-Off) The first major advance was the Tet-Off system. A tetracycline-controlled...conditions, the TetR protein binds to tet O, blocking transcription of the downstream gene. If tet or one of...highlighted Tet plasmids . Figure 1: Tet-regulated expression systems. Left: natural TetR mechanism; center...known as the tTA-dependent or tet-repressible system. Tetracycline On (Tet-On) In 1995, Gossen et al. used...
-
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...-MCS-EGFP - Tet-inducible Find more Tet-inducible empty backbones on our Tetracycline (Tet) Inducible ...vector for mammalian genome editing Tet-pLKO-puro and Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression...Expresses ultraID in mammalian cells with the Tet-On or Tet-Off system Return to top Selectable Markers ...Backbones Neomycin (G418) Mammalian, Varies Tet-pLKO-neo - Tet-inducible lentiviral shRNA expression Find...Neomycin selection Puromycin Mammalian Tet-pLKO-puro - Tet-inducible lentiviral shRNA expression...vector with N- or C-terminal HA tag pInducer20 - Tet-inducible HA-tagged lentiviral vector for ORF expression...vector for gene expression pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral Gateway destination vector for... -
AAV Molecular Tools
TypeCollection...can be used with tetracycline (tet)-inducible expression systems . ID Name Expression System Activity ...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1... available from Addgene's viral service encoding tet-off transactivators and tools for affinity purification...pAAV-CAG-tTA CAG-driven, constitutive Expression of the tet-off transactivator (tTA) 2 Gradinaru 99120 pAAV-ihSyn1...Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator (tTA) with a positive feedback...promoter (ihSyn) Cre-dependent expression of the tet-off transactivator (tTA) with a positive feedback...Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell Ablation Tetracycline Transactivators... -
Lentivirus Plasmids
TypeCollection...14749 for Thy1.1 selection. Benoist and Mathis 21915 Tet-pLKO-puro 3rd inducible expression of shRNA; puromycin...EF-1a-driven GFP and shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB...cDNA. Puro selection. Shih 25737 pSLIK-Hygro 3rd Tet-based inducible shRNA or cDNA expression, gateway... other versions of pSLIK. Fraser 15948 pLOVE 3rd Tet inducible gateway destination plasmid for cDNA expression...versions of this plasmid. Root 44012 pInducer20 3rd Tet-inducible lentivirus for ORF expression, multicistronic...See plasmid 21374 for dtomato version. Welm 21916 Tet-pLKO-neo 3rd inducible expression of shRNA; neomycin... -
Cre-lox system
TypeCollection... pBS537 tet-hCMV-GFPcre tet inducible Cre-GFP fusion tet-hCMV Mammalian Sauer 11961 pBS596 tet-hCMV-GFPcre...none Mammalian Sauer 11957 pBS595 tet-hCMV-EGFPcre Cre-EGFP fusion Tet inducible Mammalian Sauer 11958 ...Supernova TRE AAV Iwasato 85577 pTC-CMV-Tet CreER expression and tetracyclin-dependent transgene/shRNA expression...ApoE.HCR.hAAT Mammalian Ehmer 85578 pTC-ApoE-Tet CreER expression and tetracyclin-dependent transgene/shRNA expression...tet-hCMV-GFPcre tet inducible Cre-GFP fusion, metallothionein MT-I region including the polyadenylation site and...and several introns tet-hCMV Mammalian Sauer 12168 pMB80 (R26-CreER) Cre-ERT2 with loxp cassette; Targeting...Mammalian Messing 45359 pNK-TGCK Cre-EGFP fusion; Tet inducible - rrTA expression driven by mouse Nkx cardiac... -
Plasmid Collections
TypeCollection...Microbiology Plant Expression Stem Cells Synthetic Biology Tet Inducible Expression Worm Expression Kits Kits are... -
Bikard Lab - CRISPR Repression Collection
TypeCollection...strain expressing two reporters and dCas9 under a P-tet promoter integrated in the chromosome at phage attachment...allows for quick integration of the aTc-inducible pTet-dCas9 in the attachment site of the phage 186. Detailed... -
Mammalian RNAi Tools
TypeCollection...that allow for conditional (Cre-lox) or inducible (Tet) expression are available. To find plasmids containing... -
Retrovirus Plasmids
TypeCollection...retroviral plasmid Vignali 27995 TtRMPVIR CMV/MSV Tet-regulated expression of shRNA; expresses rtTA. See...resistance. Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in... -
Neurodegeneration Research Collection
TypeCollection... bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression of transcription factors for... -
Validated gRNA Sequences
TypeCollection...24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim TET promoter...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere... -
Luciferase Plasmid Collection
TypeCollection...Luciferase Firefly TRE Lentiviral vector with dox- or tet-inducible luciferase expression Stephen Tapscott ...expression of firefly luciferase William Kaelin 60495 pSBtet-GP Firefly TRE Dox-inducible expression of firefly... -
Bacterial Expression Systems
TypeCollection...Controlled Expression Resources Check out our Tetracycline (Tet) Inducible Expression Collection for an extensive...Expression Species PI 44249 pdCas9-bacteria pTetO Anhydrotetracycline (aTc) Escherichia coli Stanley Qi 11518...coli Andreas Moeglich 68940 pRMC2 Pxyl/TetO Anhydrotetracycline (aTc) Staphylococcus aureus Tim Foster...glutamicum Timothy Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium...tuberculosis Sabine Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium...extorquens Christopher Marx 44448 pLC291 pR/TetO Anhydrotetracycline (aTc) Methylobacterium extorquens Christopher...baumannii Jason Peters 127088 pMS17 tcp830 Anhydrotetracycline (aTc) Streptomyces sp. Maggie Smith 74065... -
Brain Initiative Collection
TypeCollection...Gradinaru 117383-AAV1 TRE-DIO-eYFP An AAV genome with tet-inducible, Cre-dependent expression of the fluorescent... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection... Wheeldon FgH1tUTG 70183 Mammalian/Lentiviral H1-Tet none S. pyogenes Herold lentiGuide-Crimson 70683 ...Zhang pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA 73796 Yeast pRPR1(TetO) yes, interfere S. pyogenes...yes, nick S. pyogenes Duchek pAC5-dual-dCas9VP48-sgTetO 48237 Mammalian BbsI yes, activate S. pyogenes ...Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes Elverlov-Jakobsen...62315 Yeast none S. pyogenes URA3 Lim, Qi pRPR1(1xTetO)_gRNA_handle_RPR1t 62966 Yeast HindIII none S. ...pyogenes EGFP Zou pRS416gT-GalL-Cas9 79903 Yeast RPR1(TetO) yes, cut S. pyogenes URA3 Davis eSpCas9(1.1) 71814... -
Genetic Code Expansion
TypeCollection...Ryan Mehl 85496 pDule-Tet2.0 Tetrazine2.0 tRNA synthetase M. jannaschii Tetrazine 2.0 Bacterial TAG Ryan...Ryan Mehl 85497 pDule2-Tet2.0 Tetrazine2.0 tRNA synthetas M. jannaschii Tetrazine 2.0 Bacterial TAG Ryan...Bacterial TAG Ryan Mehl 164580 pUltraI-Tet3.0[TAA] Tet3.0RS M. barkeri Tet3.0 Bacterial TAA Ryan Mehl 172482 ...TAG Ryan Mehl 174080 pDule-Tet3.0 Tet3.0 tRNA synthetase M. barkeri Tetrazine 3.0 Bacterial TAG Ryan Mehl...NES-Flag-R2-84-MbRS Tetrazine3.0 NES-Flag-R2-84 tRNA synthetase M. barkeri Tetrazine 3.0 Mammalian Ryan...aminoacyl-tRNA synthetase M. jannaschii 1,2,4,5-tetrazine ncAAs Bacterial TAG Ryan Mehl 217361 pIDTSmart-MbPylRS... -
Fluorescent Protein Guide: Biosensors
TypeCollection...sensors, ER-targeted CEPIA1er ER-mitochondria tethering by PDZD8 regulates Ca(2+) dynamics in mammalian...Yulong Li ADP Biosensor for ADP based on tetramethylrhodamine-labeled ParM A fluorescent, reagentless ...reagentless biosensor for ADP based on tetramethylrhodamine-labeled ParM. ACS Chem Biol. 2010 Apr 16;5(4):415-25...single cells. Angew Chem Int Ed Engl. 2018 Jun 27. Tetsuya Kitaguchi ATP Variants of ATP sensor iATPSnFR1.0...dual-color imaging. PLoS One. 2014 Jun 24;9(6):e100252. Tetsuya Kitaguchi cAMP (cyclic AMP) Red fluorescent protein-based...in vivo imaging. Sci Rep. 2017 Aug 4;7(1):7351. Tetsuya Kitaguchi cAMP (cyclic AMP) Fluorescent sensor ...and PDE5alpha. ACS Sens. 2017 Jan 27;2(1):46-51. Tetsuya Kitaguchi cGMP (cyclic GMP) FlincG3 (GFP-based ... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...eqFP611 559 611 35 Tetramer eqFP611-N1 - Mammalian Expression DsRed2 563 582 24 Tetramer pCAG-DsRed2 - Mammalian...CYPet-C1 - Mammalian Expression AmCyan1 453 486 11 Tetramer AmCyan1-N1 - Mammalian Expression MiCy (Midoriishi-Cyan...Expression (cysteine-free SGFP2) ZsGreen 493 505 39 Tetramer pHIV-Zsgreen - Mammalian Expression (this is a...YPet-pBAD - Bacterial Expression ZsYellow1 529 539 8 Tetramer ZsYellow1-N1 - Mammalian Expression mPapaya1 530...Expression Kaede 508 / 572 518 / 580 87 / 20 5.6/5.6 Tetramer Kaede-N1 - Mammalian Expression Kaede-C2 - Mammalian... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TTGAGGACCATGACGTGCagctggagactgaagaGAGCAAGAAAGTTGGGAA tet2(ENSDART00000113020) TAL3376 & TAL3377 TCAAGACCAGATACTATCcccaagcttcctttccCAGCTACCACCTACTGAA...TCAAGACCAGATACTATCcccaagcttcctttccCAGCTACCACCTACTGAA tet3(ENSDART00000137355) TAL3378 & TAL3379 TTGCTCCTTGGTTGCATCtctgtcttcattatcaCAAACATTTTCTTCATTA...TTGCTCCTTGGTTGCATCtctgtcttcattatcaCAAACATTTTCTTCATTA tetmethylcytosinedioxygenase 1 TAL3572 & TAL3573 TCAACTCGCGCATCCACAaagcgaaatgttaagaGGGTGAAGGCTTCCATGA...TCAACTCGCGCATCCACAaagcgaaatgttaagaGGGTGAAGGCTTCCATGA tetmethylcytosinedioxygenase 3 TAL3574 & TAL3575 TTATTAGGCACTTTTTTGtaaacgctgtattccaTGCACTTTCCTGTCCACA...TTATTAGGCACTTTTTTGtaaacgctgtattccaTGCACTTTCCTGTCCACA tetmethylcytosinedioxygenase 3 (previous si:ch211-220a11.1) TAL3576... -
Fluorescent Protein Guide: FRET
TypeCollection...-5aa linker-Cerulean-6aa linker-Venus ACAV Heterotetrameric construct consisting of Amber-5aa linker-Cerulean...linker-Cerulean-5aa linker-Amber-6aa linker-Venus ACVA Heterotetrameric construct consisting of Amber-5aa linker-Cerulean...linker-Cerulean-5aa linker-Venus-6aa linker-Amber VCAA Heterotetrameric construct consisting of Venus-5aa linker-Cerulean...linker-Cerulean-5aa linker-Amber-6aa linker-Amber VCVV Heterotetrameric construct consisting of Venus-5aa linker-Cerulean...