Skip to main content

We narrowed to 31 results for: tre promoter

Showing: 1 - 20 of 31 results
  1. Tetracycline Inducible Expression

    Type
    Collection
    ...unable to bind the TRE. In the presence of tetracycline, rtTA binds the TRE, promoting gene expression. ...and EGFP. Pbi contains a TRE between two minimal CMV promoters. None Pbi (TRE, miniCMV) Bert Vogelstein...Response Element (TRE) typically features seven copies of tet O upstream of a minimal CMV promoter, and other...introduced the TRE, placing seven copies of tet O upstream of the minimal CMV promoter. In the absence...may also like... Blog: Inducible Promoters Blog: Repressible Promoters Mammalian shRNA Plasmids Collection... of tetracycline, tTA binds to the TRE and its VP16 domain promotes gene expression. In the presence of...fold induction of the gene of interest. Tight TRE promoter or P Tight : reduced background expression and...
  2. Luciferase Plasmid Collection

    Type
    Collection
    ...of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion of 5' promoter/enhancer... reporter vector. Insertion of 5' promoter/enhancer regions upstream of Firefly luciferase. Renilla luciferase...tool for scientists. Regulatory elements such as promoters, enhancers and untranslated regions, or shRNA ...Jorge Ferrer 16539 pBV-Luc Firefly Insertion of 5' promoter/enhancer regions Bert Vogelstein 12178 pIS0 Firefly... Renilla luciferase under the control of a CMV promoter is present for normalization William Kaelin 71248...71248 pXPG Firefly Insertion of 5' promoter/enhancer regions. Mutations within the luciferase gene allow...
  3. AAV Molecular Tools

    Type
    Collection
    ...Gradinaru 99120 pAAV-ihSyn1-tTA Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator...pAAV-ihSyn1-DIO-tTA Cre-dependent and inducible Synapsin promoter (ihSyn) Cre-dependent expression of the tet-off...amplified tTA expression. 1 Viviana Gradinaru 117383 TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible...
  4. Lentivirus Plasmids

    Type
    Collection
    ...shRNA under the control of a tet-responsive H1 promoter. Didier Trono 11651 pLVUT-tTR-KRAB 3rd Inducible...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor...epigenetic silencing. Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor...with a chimeric 5’LTR. Any expression cassette (promoter and gene of interest) can be cloned into the plasmid.... Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP...41393 pCW57.1 3rd Inducible lentiviral expression, TRE-gateway, with puromycin selection. See Root Lab pLEX... GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin selection. See Campeau et al. (2009...
  5. Brain Initiative Collection

    Type
    Collection
    ...fluorescent protein eYFP from the hSyn1 promoter Viviana Gradinaru 117383-AAV1 TRE-DIO-eYFP An AAV genome with tet-inducible...-mCherry Expression of hM4D(Gi) using the CD68 promoter. Bryan Roth 75033-AAV9 pAAV CD68-hM4D(Gi)-mCherry...mCherry Expression of hM4D(Gi) using the CD68 promoter. Bryan Roth 83894-AAV1 pAAV-hDlx-Flex-dTomato-Fishell...An AAV genome that expresses tTA from the hSyn1 promoter that contains a positive feedback loop for amplifed...Cre-dependent expression of the tTA from the hSyn1 promoter. Contains a positive feedback loop for amplifed...recombinase-dependent expression of mNeonGreen from the CAG promoter Viviana Gradinaru 100798-AAV1 pAAV-syn-FLEX-splitTVA-EGFP-tTA...expression of the fluorescent protein EYFP from the CAG promoter Viviana Gradinaru 104055-AAV2 pAAV-CAG-eYFP An...
  6. Bacterial Expression Systems

    Type
    Collection
    ...coli strain. Addgene Blog Inducible Promoters Repressible Promoters Synthetic Photobiology: Optogenetics...pRU1701 Promoter activity Fluorescence (GFP+) Gram-negative bacteria Philip Poole 14460 pOT2 Promoter activity...pCHERRY3 Promoter activity Fluorescence (mCherry) Mycobacterium sp. Tanya Parish 24657 pASTA3 Promoter activity...#1000000037) contains specific bacterial promoters that vary in strength and that can be used to reliably drive...periplasmic localization: PelB, MalE, OmpA ID Plasmid Promoter Tags PI Additional Addgene Protein Purification...Toolkit (Addgene #1000000080) features a library of promoters and purification tags compatible with Golden Gate...temperature, in different bacterial systems. ID Plasmid Promoter Inducer Expression Species PI 44249 pdCas9-bacteria...
  7. Plant Plasmids and Resources

    Type
    Collection
    ...containing promoters that drive general and species-specific gene expression (see the column ‘promoter’ in the...for, such as the promoter or cloning method of choice. ID Plasmid Description Promoter Cloning Method PI...Synthetic Biology Research Centre (Link opens in a new window) - The initiative promotes interdisciplinary exchange... nucleases, base editors, gRNA backbones, and promoters for expression in monocots and dicots - Vladimir... for features you are looking for, such as the promoter or fluorescent protein of choice. Visit our Fluorescent...Proteins Guide for more. ID Plasmid Description Promoter PI Return to top Other Resources Addgene Blog ...modules for assembly of CRISPR/Cas9 constructs - Sylvestre Marillonnet and Johannes Stuttmann. Combined fluorescent...
  8. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Browse CRISPR...for directed evolution. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas...-directed repair (HDR). ID Plasmid Gene/Insert Promoter Selectable Marker Publication Prime Edit Cas9 ...edits on an RT template. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...
  9. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function... on the opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR/Cas nickase mutants...-directed repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused...edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...
  10. Caltech Systemic Capsids

    Type
    Collection
    ... window) . Browse Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato... #103006) . Browse Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato...#127847) . Browse Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP...#185136) . Browse Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#185137) . Browse Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175004) . Browse Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175005) . Browse Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...
  11. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...specific times or locations using cell-specific promoters or inducible systems, you can precisely control...fragments and placed under the control of different promoters. Expression of both fragments in the same cell... lox-STOP-lox shRNA constructs, Cre expression promotes shRNA expression. Gene Switch: These constructs...plasmids based on your expression system of choice, promoter, or search by inducible system (e.g., search for...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Explore our full...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Search our full...
  12. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...interest to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated ...proteins, a multiple cloning site (MCS), an inducible promoter, and/or a selectable marker. They are frequently...T-DNA entry plasmid (attR1 & attR2); Zea mays Ubi1 promoter and Hygromiycin resistance marker Also see more... expression under the metallothionein promoter pFastBac LIC and pFastBac Dual LIC - Vectors from...Gileadi lab Worm unc-54, variety of worm gene promoters C. elegans vector kit - Collection...
  13. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...Insert Promoter Selectable Marker PI Publication Return to top Plant ID Plasmid Gene/Insert Promoter Selectable...CRISPR Guide . Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top...Publication Return to top Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top...top Zebrafish ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top CRISPR Resources...engineered to convert adenosine to inosine, which is treated like guanosine by the cell, creating an A to G ...
  14. mTOR Pathway

    Type
    Collection
    ...signals. mTORC2, which appears to signal upstream of Akt, also promotes cell survival and proliferation. mTOR...anabolic to catabolic processes. Active mTORC1 promotes protein and lipid synthesis, and increases energy... cancer. Loss of the tumor suppressor p53 also promotes aberrant mTORC1 activity, and multiple familial...mTORC1. The hyperactivation of mTORC1 in cancer promotes the conditions needed for uncontrolled cell growth...responds to various signals, including amino acids, stress, oxygen, energy levels, and growth factors. mTORC1...ovarian, and liver cancers. mTORC1 is activated downstream of PI3K/Akt and MAPK/ERK, both of which are commonly...
  15. Validated gRNA Sequences

    Type
    Collection
    ...CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S.... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m...GTTGAAAGTATTAGTTAAAG 64388 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate...
  16. Depositor Collections

    Type
    Collection
    ...Community (MCC) Collection Pleiades Promoter Project: mini-promoters to drive selective expression in the...Syndrome Plasmid Collection and Resource Center TREAT-AD Plasmid Collection Visualization Michael Davidson...
  17. Plan Your Experiment

    Type
    Collection
    ...template Cas9 or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency...prime editing. CRISPR Intereference : Target the promoter region of the gene of interest, where the Cas9...approaches, the species and expression pattern of the promoter for both your Cas enzyme and gRNA and the presence...the wide range of options for the Cas enzyme, promoters, and selection markers. There are also no packaging...to specific cell types by using cell-specific promoters, which is useful for in vivo studies. While we...transfect, transduce, or may not express common promoters. Browse Cas9 plasmids for RNP delivery . As mentioned...protein product. Be aware that there could be downstream translation start sites that could allow for ...
  18. Worm Expression Resources

    Type
    Collection
    ...recombinase from either a heat-shock promoter or a tissue-specific promoter and expression of the target FLP-out... from either a ubiquitous or a tissue-specific promoter. cGAL and Split cGAL plasmids - Paul Sternberg...Jorgensen Lab. A collection of plasmids that streamlines the production of targeting vectors for tag insertion...
  19. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...sgRNA with U6 promoter 48962 Worm HindIII none S. pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm ...of two sgRNAs from independent U6 promoters and Cas9 from CBh promoter. Ventura A CRISPR/Cas9 toolkit for...along with 1-4 sgRNAs expressed from independent promoters. sgRNAs are cloned into separate vectors and then... assembly of single gRNA vectors with various promoters, plasmids for assembling multiple gRNAs into one...pGGDestTol2LC vector. Uses five distinct zebrafish U6 promoters for sgRNA expression. Chen pCFD4-U6:1_U6:3tandemgRNAs...expression of two gRNAs from Drosophila U6:1 and U6:3 promoters. Bullock pCFD5 Drosophila Utilizes endogenous ...Zhang Cas9/pTREX-n 68708 Other/Trypanosoma cruzi yes, cut S. pyogenes Neo Docampo tdTomato/pTREX-b 68709 ...
  20. Zhang Lab CRISPR Page

    Type
    Collection
    ...Truncated MeCP2 promoter-driven SpCas9; for neuronal expression 60958 : PX552; U6 promoter-driven; for sgRNA...tyroxine binding globulin (TBG, PX602 [#61593] ) promoter, and a U6-driven single guide RNA. The vector ...codon-optimized SpCas9, driven by the truncated MeCP2 promoter (pAAV-pMecp2-SpCas9-spA) for expressing Cas9 in...FA, Hsu PD, Lin CY, Gootenberg JS, Konermann S, Trevino AE, Scott DA, Inoue A, Matoba S, Zhang Y, Zhang...CRISPR-Cas9 complex. Konermann S*, Brigham MD*, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib...
Showing: 1 - 20 of 31 results