Skip to main content
Addgene
Showing: 1 - 20 of 35 results

  1. Tetracycline Inducible Expression

    Type
    Collection
    ...the TRE, permitting transcription. Tetracycline-dependent promoters are developed by placing a TRE upstream...third-generation rtTA On Elledge 19407 pTREtight2 Promoter contains a modified TRE that is silent in absence of ...inducible promoters capable of controlling eukaryotic gene expression. Several endogenous promoters had been...plasmids. Tet System and the Tet Response Element (TRE) A TRE is seven repeats of a 19 nucleotide tetracycline...from a bidirectional tet-responsive promoter (Pbi); Pbi contains a TRE between two minimal CMV and is silent....CMV.tTA Adenoviral; CMV promoter; see article for neuronal-specific promoter and enhancer options tTA...

  2. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...expressing Rep2 and PHP.eB Cap controlled by tTA-TRE amplification system Gradinaru 103006 pUCmini-iCAP-PHP.S... expressing Rep2 and PHP.S Cap controlled by tTA-TRE amplification system Gradinaru 127847 pUCmini-iCAP-PHP.V1...expressing Rep2 and PHP.V1 Cap controlled by tTA-TRE amplification system Gradinaru 175004 pUCmini-iCAP-AAV.CAP-B10...), expressing Rep2 and B10 Cap controlled by tTA-TRE amplification system Gradinaru 175005 pUCmini-iCAP-AAV.CAP-B22...), expressing Rep2 and B22 Cap controlled by tTA-TRE amplification system Gradinaru 185136 pUCmini-iCAP-AAV.MaCPNS1...expressing Rep2 and MaCPNS1 Cap controlled by tTA-TRE amplification system Gradinaru 185137 pUCmini-iCAP-AAV.MaCPNS2...expressing Rep2 and MaCPNS2 Cap controlled by tTA-TRE amplification system Gradinaru RepCap Plasmids for...

  3. Cre-lox system

    Type
    Collection
    ...Stainier 85040 pK170.AAV-TRE-Cre-WPRE (Supernova) TRE-Cre based Supernova TRE AAV Iwasato 85577 pTC-...system is tight temporal regulation. Promoter-regulated Cre: The promoter region defines the areas in which...active promoter like CAG, or expressed only in a subset of cells under a more specific promoter (e.g. ... PBAD promoter Bacterial Richmond 112614 pVHC Venus and Cre-ERT2 with MCS for inserting promoter none ...inserting promoter none Mammalian Heller 112616 pmTHC TFP and Cre-ERT2 with MCS for inserting promoter none...GFP and Cre CMV Lentiviral Lu 118029 pAAV-TRE-dDIO-vCre VCre TRE AAV Luo 119063 pBac(3xP3-gTc’v; Tc-hsp68...CAG Mammalian Zhang 68477 pTRE:iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, and GFP TRE Mammalian Jacks 68544 AAV-Cre-GFP...

  4. Qi Lab CRISPR Page

    Type
    Collection
    ...controlled by SNR 52 promoter, targeting endogenous TRE elements of pTET07 promoter...retroVirus LTR promoter. The second plasmid ( pgRNA_humanized ) contains a murine U6 promoter controlled ...vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter 46916 pU6-sgGAL4-4 Human pSico-based...vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter (negative control) 46918 pU6...contains sgRNA controlled by SNR 52 promoter, targeting endogenous TEF1 promoter 46923 pSNR52-sgTET Yeast CEN...pHR-SFFV-dCas9-BFP Human expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS and tagBFP 46911...BFP-KRAB Human expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS, tagBFP and a KRAB...

  5. AAV Molecular Tools

    Type
    Collection
    ...Gradinaru 99120 pAAV-ihSyn1-tTA Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator...pAAV-ihSyn1-DIO-tTA Cre-dependent and inducible Synapsin promoter (ihSyn) Cre-dependent expression of the tet-off...for amplified tTA expression. 1 Gradinaru 117383 TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible...

  6. Lentivirus Plasmids

    Type
    Collection
    ...shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor...silencing were added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor...with a chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned into the plasmid...coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP...41393 pCW57.1 3rd Inducible lentiviral expression, TRE-gateway; PGK-rtTA-2A-puro. See article for more versions...

  7. Brain Initiative Collection

    Type
    Collection
    ...fluorescent protein eYFP from the hSyn1 promoter Viviana Gradinaru 117383-AAV1 TRE-DIO-eYFP An AAV genome with tet-inducible...-mCherry Expression of hM4D(Gi) using the CD68 promoter. Bryan Roth 75033-AAV9 pAAV CD68-hM4D(Gi)-mCherry...mCherry Expression of hM4D(Gi) using the CD68 promoter. Bryan Roth 83894-AAV1 pAAV-hDlx-Flex-dTomato-Fishell...An AAV genome that expresses tTA from the hSyn1 promoter that contains a positive feedback loop for amplifed...Cre-dependent expression of the tTA from the hSyn1 promoter. Contains a positive feedback loop for amplifed...recombinase-dependent expression of mNeonGreen from the CAG promoter Viviana Gradinaru 100798-AAV1 pAAV-syn-FLEX-splitTVA-EGFP-tTA...expression of the fluorescent protein EYFP from the CAG promoter Viviana Gradinaru 104055-AAV2 pAAV-CAG-eYFP An...

  8. Luciferase Plasmid Collection

    Type
    Collection
    ...renilla_polyA Firefly/Renilla Insertion of 5' promoter/enhancer regions upstream of Firefly luciferase. Renilla luciferase...pSGDlucV3.0 Firefly/Renilla Insertion of 5' promoter/enhancer regions upstream of Firefly luciferase. Renilla luciferase...investigate the effect of regulatory elements, such as promoters, enhancers and untranslated regions, or the effect...available that are driven by a strong constitutive promoter and can be used to monitor transfection or viral...plasmids by using the bacterial ORI as the core promoter, which was a source of false positives with the...Description PI 16539 pBV-Luc Firefly Insertion of 5' promoter/enhancer regions Bert Vogelstein 12178 pIS0 Firefly... Renilla luciferase under the control of a CMV promoter is present for normalization William Kaelin 71248...

  9. Bacterial Expression Systems

    Type
    Collection
    ...expression. pCW-LIC 26098 3x Tac promoter (hybrid of trp and lac promoters with higher expression upon induction...trp and lac promoters (Lactose/IPTG inducible) Various combinations of N and C-terminal Strep and His tags...function, structure, and interactions! Plasmid ID Promoter Epitope Tag(s) ID Purpose pDEST-HisMBP 11085 Tac...with your gene/protein of interest. Plasmid ID Promoter Inducer(s) PI Purpose Murray Lab pBEST plasmids... from Promega. Contain a variety of inducible promoters, their associated transcription factors, and reporter...by the quorum sensing molecule, 3OC6HSL, from a promoter repressed by EsaR. Designed to be used with the... sensitivities to 3OC6HSL. The EsaR-responsive promoter can be found in pCS-PesaRlux controlling luciferase...

  10. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...Representative Empty Backbones Promoter Measure promoter strength pBV-Luc - Luciferase ...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...vector (PGK1 promoter, 2μ) pXP316 - Yeast expression vector (TEF1 promoter, CEN/ARS) pAG304GAL-ccdB...vector (PGK1 promoter, CEN/ARS) pXP222 - Yeast expression vector (PGK1 promoter, 2μ) pAG305GAL-ccdB... vectors with various markers, promoters, etc pRS420 - Yeast expression ... expression under the metallothionein promoter pACU2 - Modified pUAST vector containing... transgenes Worm unc-54, variety of worm gene promoters C. elegans vector kit - Collection...

  11. Plant Plasmids and Resources

    Type
    Collection
    ...containing promoters that drive general and species-specific gene expression (see the column ‘promoter’ in the...for, such as the promoter or cloning method of choice. ID Plasmid Description Promoter Cloning Method PI..., such as the promoter or fluorescent protein of choice. ID Plasmid Description Promoter PI Return to ...Synthetic Biology Research Centre (Link opens in a new window) - The initiative promotes interdisciplinary exchange... nucleases, base editors, gRNA backbones, and promoters for expression in monocots and dicots - Vladimir...modules for assembly of CRISPR/Cas9 constructs - Sylvestre Marillonnet and Johannes Stuttmann. Combined fluorescent...

  12. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Browse CRISPR...for directed evolution. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas...-directed repair (HDR). ID Plasmid Gene/Insert Promoter Selectable Marker Publication Prime Edit Cas9 ...edits on an RT template. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...

  13. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function... on the opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR/Cas nickase mutants...-directed repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused...edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...

  14. Caltech Systemic Capsids

    Type
    Collection
    ... window) . Browse Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato... #103006) . Browse Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato...#127847) . Browse Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP...#185136) . Browse Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#185137) . Browse Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175004) . Browse Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175005) . Browse Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...

  15. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable...Gene/Insert Promoter Selectable Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable ...PI Publication Zebrafish ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions...engineered to convert adenosine to inosine, which is treated like guanosine by the cell, creating an A to G ...

  16. mTOR Pathway

    Type
    Collection
    ...signals. mTORC2, which appears to signal upstream of Akt, also promotes cell survival and proliferation. mTOR...anabolic to catabolic processes. Active mTORC1 promotes protein and lipid synthesis, and increases energy... cancer. Loss of the tumor suppressor p53 also promotes aberrant mTORC1 activity, and multiple familial...mTORC1. The hyperactivation of mTORC1 in cancer promotes the conditions needed for uncontrolled cell growth...responds to various signals, including amino acids, stress, oxygen, energy levels, and growth factors. mTORC1...ovarian, and liver cancers. mTORC1 is activated downstream of PI3K/Akt and MAPK/ERK, both of which are commonly...

  17. Validated gRNA Sequences

    Type
    Collection
    ...CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S.... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m...GTTGAAAGTATTAGTTAAAG 64388 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate...

  18. Plan Your Experiment

    Type
    Collection
    ...Cas enzyme and gRNA Species of promoter and expression pattern of promoter for Cas enzyme and gRNA Presence...Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically...such as dCas9-KRAB) or dCas9 gRNA(s) targeting promoter elements of target gene dCas9-KRAB is more effective...activator (such as dCas9-VP64) gRNA(s) targeting promoter elements of target gene Many different activators...dCas9-repressors, gRNAs should be targeted to the promoter driving expression of your gene of interest. For...containing a G nucleotide at position 20 (1 bp upstream of the PAM) may be more efficacious than gRNAs...amplified, PCR products are denatured-renatured, treated with a nuclease that cleaves DNA heteroduplexes...

  19. Depositor Collections

    Type
    Collection
    ...Community (MCC) Collection Pleiades Promoter Project: mini-promoters to drive selective expression in the...Syndrome Plasmid Collection and Resource Center TREAT-AD Plasmid Collection Visualization Michael Davidson...

  20. Worm Expression Resources

    Type
    Collection
    ...recombinase from either a heat-shock promoter or a tissue-specific promoter and expression of the target FLP-out... from either a ubiquitous or a tissue-specific promoter. cGAL and Split cGAL plasmids - Paul Sternberg...Jorgensen Lab. A collection of plasmids that streamlines the production of targeting vectors for tag insertion...
Showing: 1 - 20 of 35 results